View Full Version : "Abortion Super Center" to open in Houston
Play The Man
01-06-2010, 05:22 PM
http://cnsnews.com/news/article/59334
A coalition of pro-life advocates and religious leaders plan to gather in Houston on Jan. 18 to oppose what is expected to be the largest abortion clinic in the country.
Planned Parenthood is renovating a former bank, turning it into a 78,000 square foot facility that will include a surgical wing equipped to provide late-term abortions.
“It’s an abortion super center,” Lou Engle, founder of the pro-life group The Call to Conscience, which is organizing the rally, told CNSNews.com.
Joining Engle at the “prayer march” will be Tony Perkins, president of the Family Research Council, and Samuel Rodriguez, president of the National Hispanic Christian Leadership Conference. Religious leaders expected to attend include Bishop Harry Jackson, senior pastor of Hope Christian Church; Richard Land, president of the Ethics and Religious Liberty Commission of the Southern Baptist Convention; Star Parker, president of the Coalition for Urban Renewal and Education; and Abby Johnson, the former director of a Planned Parenthood clinic.
Engle compared the fight for the rights of the unborn to another critical movement in America. “As Martin Luther King, Jr. said, ‘It is time to subpoena the conscience of America,’” he said.
Engle said he believes the clinic was strategically located in a part of Houston that is surrounded by black and Hispanic neighborhoods.
“We want to say that it’s not right to have an abortion super center that targets the minority community,” Engle said. He says Planned Parenthood actively markets its services, including abortion, to low-income, minority women.
Last month, Houston elected the first lesbian, Annise Parker, to hold the mayoral office in a major U.S. city. Until her inauguration this week, the director of Health and Environmental Policy for the mayor’s office was Elena Marks, chairwoman of the Planned Parenthood Federation of America.
Attempts to reach Marks for comment on the clinic and the planned rally were unsuccessful.
What is happening to Houston?
Maybe they will have a grand opening sale. If you have twins or triplets you can get a "2 for 1" special or even a "3 for 1" special. Maybe they will even have a "Ladies' Night" where an abortion of a female fetus is free. Perhaps even a "Frequent Fliers" Club - get a stamp on your card for each abortion and when you accrue a half-dozen you get a free DVD player. :sad:
billwilliams70
01-06-2010, 05:32 PM
How can a man be found guilty of 2 counts of homicide if he kills a pregnant woman and her baby, but abortion isn't considered murder?
Scott Peterson was charged with double murder (fetal homicide) in his wife's case.
Public Law recognizes a "child in utero" as a legal victim, "child in utero" is defined as a human being, at any stage of development, when carried in the whom.
:huh:
Later.
rearnakedchoke
01-06-2010, 05:58 PM
How can a man be found guilty of 2 counts of homicide if he kills a pregnant woman and her baby, but abortion isn't considered murder?
Scott Peterson was charged with double murder (fetal homicide) in his wife's case.
Public Law recognizes a "child in utero" as a legal victim, "child in utero" is defined as a human being, at any stage of development, when carried in the whom.
:huh:
Later.
yeah, doesn't make sense
Vizion
01-06-2010, 06:24 PM
God is going to judge America for sins like this.
Be ware.
billwilliams70
01-06-2010, 07:54 PM
I'm generally not all that into the "Pro-Life Scene", but I think that this is a cool shirt......
http://www.c28.com/productimages/guys_Noticed_FRNT.png
http://www.c28.com/shopping/productdetails.asp?recordid=12409
Later.
eric84
01-06-2010, 08:19 PM
How can a man be found guilty of 2 counts of homicide if he kills a pregnant woman and her baby, but abortion isn't considered murder?
Scott Peterson was charged with double murder (fetal homicide) in his wife's case.
Public Law recognizes a "child in utero" as a legal victim, "child in utero" is defined as a human being, at any stage of development, when carried in the whom.
:huh:
Later.
Because it's ok to murder now if something is an inconvenience. I mean, isn't it only fair that if I get myself pregnant that I can murder an innocent child so I don't have to deal with the responsibility? I have to reply to this in a sarcastic manner because it sickens me so much that things like this are so blatantly out in the open and the American people allow it.
Shoots like a girl
01-06-2010, 08:37 PM
Anyone who wants an abortion should have to watch a film called the silent scream. Its available at any Christian bookstore. What have we been reduced to? Killing children. Murdering the innocent. I dont know what to say. There are just no words. We can murder babies but we have to treat accused terrorists fairly? I would hate to have to stand before God with that on my soul. :cry:
billwilliams70
01-06-2010, 08:52 PM
Because it's ok to murder now if something is an inconvenience. I mean, isn't it only fair that if I get myself pregnant that I can murder an innocent child so I don't have to deal with the responsibility? I have to reply to this in a sarcastic manner because it sickens me so much that things like this are so blatantly out in the open and the American people allow it.
I know how you feel.
Anyone who wants an abortion should have to watch a film called the silent scream. Its available at any Christian bookstore. What have we been reduced to? Killing children. Murdering the innocent. I dont know what to say. There are just no words. We can murder babies but we have to treat accused terrorists fairly? I would hate to have to stand before God with that on my soul. :cry:
I couldn't agree more.
Later.
MattHughesRocks
01-06-2010, 09:03 PM
God is going to judge people you mean...
God is going to judge America for sins like this.
Be ware.
Miss Foxy
01-06-2010, 09:23 PM
I am sad for those innocent babies..:sad:
Spiritwalker
01-06-2010, 10:32 PM
When I was younger.. (late teens.. early 20s) I had no problem with abortion.. I was also uninformed.... even though a live in girl friend had one. I still feel really guilty about that.
in my late 20s and early 30s... I had a problem with abortion.. even though... I still would support the "right"..
Now in my early 40s.. I am having a tougher time with "understanding"....
I have never been in favor of a late term abortion...
In my mind.. anything past the first 3 months should be considered murder..
But then I have to consider... rapes.. children that will be born with horrid problems and such..
atomdanger
01-07-2010, 01:39 AM
I am so 50/50 on abortion.
Side 1 of me says, damn, thats WRONG.
side 2 says, maybe I don't want these people breeding period,
and we might all be better off without them producing children.
I can never decide.
Chuck
01-07-2010, 01:49 AM
God is going to judge people you mean...
No, I think nation is accurate.
I am so 50/50 on abortion.
Side 1 of me says, damn, thats WRONG.
side 2 says, maybe I don't want these people breeding period,
and we might all be better off without them producing children.
I can never decide.
I would agree that "these" people should be having babies but don't you think you're punishing the wrong person?? It's the parent's who in many cases are selfish, irresponsible and uncaring yet it's the child that gets murdered.
Make no mistake.. it is a child and it is murder. Using less offensive terminology like the pro death movement does won't change the facts.
MattHughesRocks
01-07-2010, 02:10 AM
So if the girl down the street gets an abortion and I don't believe in it I'll be judged for what she did ?:unsure-1:
No, I think nation is accurate.
NateR
01-07-2010, 02:13 AM
So if the girl down the street gets an abortion and I don't believe in it I'll be judged for what she did ?:unsure-1:
GOD judges individuals and He judges nations.
Just like the German citizens from the 1930s and 40s are culpable for the actions of the Nazis and the Jewish Holocaust; we as Christian Americans are to blame for what is turning into the greatest mass slaughter of human beings in the history of the world: The Pro-Choice movement.
When I was younger.. (late teens.. early 20s) I had no problem with abortion.. I was also uninformed.... even though a live in girl friend had one. I still feel really guilty about that.
in my late 20s and early 30s... I had a problem with abortion.. even though... I still would support the "right"..
Now in my early 40s.. I am having a tougher time with "understanding"....
I have never been in favor of a late term abortion...
In my mind.. anything past the first 3 months should be considered murder..
But then I have to consider... rapes.. children that will be born with horrid problems and such..
None of it is good , in any way shape or form and it should not be allowed.
MattHughesRocks
01-07-2010, 02:19 AM
Well explain "judge" to me then I'm nervous and on just this side of getting why people try to kill the doctors performing those operations.
GOD judges individuals and He judges nations.
Just like the German citizens from the 1930s and 40s are culpable for the actions of the Nazis and the Jewish Holocaust; we as Christian Americans are to blame for what is turning into the greatest mass slaughter of human beings in the history of the world: The Pro-Choice movement.
NateR
01-07-2010, 02:35 AM
Well explain "judge" to me then I'm nervous and on just this side of getting why people try to kill the doctors performing those operations.
Well, we can't repay evil with evil. Jesus never did, so we're not allowed to either. Although I do understand how you feel, because I completely agree that every single one of them deserves to die for the profession that they have chosen. But that sentence is not ours to carry out, GOD will take care of that Himself.
The only way that the Pro-Choice movement gained as much power as it did is by changing the culture, which is what we have to do in order to get this country back to it's Christian roots.
The most effective way is for parents to train up their children to love GOD and to believe in the Bible. For those of us who don't have children, then we can help by making our beliefs publicly known and being completely unapologetic about those beliefs.
Also NEVER, NEVER, NEVER waiver or compromise those beliefs. Don't say, "I think abortion is wrong and shouldn't be allowed, unless......." All you need to say is "Abortion is always wrong and should never be allowed under any circumstances whatsoever." Don't cave in to the fallacious arguments involving rape, incest or the health of the mother. There are always other options available that don't require the murder of the child.
You might get harassed, insulted or even lose your job/family/etc.; but if you are not willing to risk discomfort, pain or death for your beliefs, then they are not really your beliefs.
MattHughesRocks
01-07-2010, 02:42 AM
Well, I definitely don't fit in to any of the parts in bold that's for sure and I doubt I'd ever let anyone harrass me into anything ever but I still don't understand what you mean about God "judging" us for it.I guess I always think of God "judging" us as going to hell...
Well, we can't repay evil with evil. Jesus never did, so we're not allowed to either. Although I do understand how you feel, because I completely agree that every single one of them deserves to die for the profession that they have chosen. But that sentence is not ours to carry out, GOD will take care of that Himself.
The only way that the Pro-Choice movement gained as much power as it did is by changing the culture, which is what we have to do in order to get this country back to it's Christian roots.
The most effective way is for parents to train up their children to love GOD and to believe in the Bible. For those of us who don't have children, then we can help by making our beliefs publicly known and being completely unapologetic about those beliefs.
Also NEVER, NEVER, NEVER waiver or compromise those beliefs. Don't say, "I think abortion is wrong and shouldn't be allowed, unless......." All you need to say is "Abortion is always wrong and should never be allowed under any circumstances whatsoever." Don't cave in to the fallacious arguments involving rape, incest or the health of the mother. There are always other options available that don't require the murder of the child.
You might get harassed, insulted or even lose your job/family/etc.; but if you are not willing to risk discomfort, pain or death for your beliefs, then they are not really your beliefs.
NateR
01-07-2010, 02:48 AM
Well, I definitely don't fit in to any of the parts in bold that's for sure and I doubt I'd ever let anyone harrass me into anything ever but I still don't understand what you mean about God "judging" us for it.I guess I always think of God "judging" us as going to hell...
In the Old Testament, GOD judged the nation of Israel by allowing them to be conquered and made into slaves. Usually when He judges nations, it's with earthly hardship.
MattHughesRocks
01-07-2010, 02:55 AM
Oh great...I'm way too high maintenance for that! People get your crap together! :scared0011:
In the Old Testament, GOD judged the nation of Israel by allowing them to be conquered and made into slaves. Usually when He judges nations, it's with earthly hardship.
Vizion
01-07-2010, 03:08 AM
God is going to judge people you mean...
Now, did you read NateR's excellent summation of my point??
..and understand it :blink:
We won't stop sinning, and God will pull His hand of protection from us. It's a guarantee.
MattHughesRocks
01-07-2010, 03:11 AM
I always understand him :rolleyes:
Now, did you read NateR's excellent summation of my point??
..and understand it :blink:
We won't stop sinning, and God will pull His hand of protection from us. It's a guarantee.
Chuck
01-07-2010, 03:24 AM
Now, did you read NateR's excellent summation of my point??
..and understand it :blink:
We won't stop sinning, and God will pull His hand of protection from us. It's a guarantee.
Will????
I think it's already happened unfortunately.....
atomdanger
01-07-2010, 04:34 AM
I would agree that "these" people should be having babies but don't you think you're punishing the wrong person?? It's the parent's who in many cases are selfish, irresponsible and uncaring yet it's the child that gets murdered.
Make no mistake.. it is a child and it is murder. Using less offensive terminology like the pro death movement does won't change the facts.
Right.
But realistically our society cannot afford to just product countless unwanted children.
Unwanted children very typically become criminals, etc....
(don't bother arguing the point, look up statistics)
Play The Man
01-07-2010, 05:58 AM
Right.
But realistically our society cannot afford to just product countless unwanted children.
Unwanted children very typically become criminals, etc....
(don't bother arguing the point, look up statistics)
Birth control is available practically on every corner. Condoms are available for free in health clinics.
Adoption is always an option. American babies available for adoption are so rare that couples frequently have to adopt from other countries.
In addition, please see the thread in the Christianity section started by AdamT. Currently, America's fertility rate is right at replacement level of 2.1 children per couple. If it weren't for immigration and a higher birthrate among Latinos, our country wouldn't even be at replacement levels. Many European countries have fertility rates below 2, even as low as 1.1. These countries are literally in a death spiral of demographic collapse. We have lost the idea that children are a blessing. We need to take better care of our kids and encourage adoption. Abortion is not the answer to our problems, it is a problem.
NateR
01-07-2010, 06:21 AM
Right.
But realistically our society cannot afford to just product countless unwanted children.
Unwanted children very typically become criminals, etc....
(don't bother arguing the point, look up statistics)
You should probably take your own advice and get an education before spouting off ridiculous nonsense like this.
Vizion
01-07-2010, 11:05 AM
I always understand him :rolleyes: Then what's the problem :laugh:
Vizion
01-07-2010, 11:23 AM
Birth control is available practically on every corner. Condoms are available for free in health clinics.
Adoption is always an option. American babies available for adoption are so rare that couples frequently have to adopt from other countries.
In addition, please see the thread in the Christianity section started by AdamT. Currently, America's fertility rate is right at replacement level of 2.1 children per couple. If it weren't for immigration and a higher birthrate among Latinos, our country wouldn't even be at replacement levels. Many European countries have fertility rates below 2, even as low as 1.1. These countries are literally in a death spiral of demographic collapse. We have lost the idea that children are a blessing. We need to take better care of our kids and encourage adoption. Abortion is not the answer to our problems, it is a problem. Yes, sadly the Europe, the place where I was born, what we know today will be virtually extinct within 50 years. It will be an ugly place filled with violence as in the Days of Noah mostlike. But when you don't have kids, you pay that price. Be prepared.
Neezar
01-07-2010, 11:23 AM
Right.
But realistically our society cannot afford to just product countless unwanted children.
Unwanted children very typically become criminals, etc....
(don't bother arguing the point, look up statistics)
I have heard other people say this. Some say that those types of people don't need to reproduce.
Chuck
01-07-2010, 12:13 PM
Right.
But realistically our society cannot afford to just product countless unwanted children.
Unwanted children very typically become criminals, etc....
(don't bother arguing the point, look up statistics)
Well.... could you show me any statistics at all to validate this statement? I'm curios when being "wanted" by your parents became something we started tracking.
Bro your statement is just ridiculous. Our society has more than enough money to fiscally support every child that's murdered in an abortion clinic. Don't bother arguing, look up statistics.
Vizion
01-07-2010, 01:20 PM
Our society has more than enough money to fiscally support every child that's murdered in an abortion clinic. Don't bother arguing, look up statistics. And heck, I have heard that the U.S. has MORE economic problems BECAUSE of the number of aborted babies who WOULD HAVE grown up to be WORKERS, ENTREPENEURS, etc...on top of that Chuck :wacko:
NateR
01-07-2010, 02:58 PM
The idea that any unplanned pregnancy will do nothing but produce a crippling drain on society is just pure brainwashed-Liberal propaganda and, like everything else that comes out of the mouth of a Liberal, a bold-faced lie.
Tyburn
01-15-2010, 06:53 PM
:sad: this is sad news :sad:
Tyburn
01-15-2010, 06:55 PM
Right.
But realistically our society cannot afford to just product countless unwanted children.
Unwanted children very typically become criminals, etc....
(don't bother arguing the point, look up statistics)
:laugh: If your country was that hard up...why does it let convicted criminals on death row die of old age.
When your country frees the money wasted on THAT...you get back to me.
MattHughesRocks
01-15-2010, 07:19 PM
That isn't an issue of the country is a State issue.Each one has their own laws.Texas, they get executed the fastest.California I believe is the slowest where it's almost guaranteed you will grow old an die before we kill you.
:laugh: If your country was that hard up...why does it let convicted criminals on death row die of old age.
When your country frees the money wasted on THAT...you get back to me.
Tyburn
01-15-2010, 07:24 PM
That isn't an issue of the country is a State issue.Each one has their own laws.Texas, they get executed the fastest.California I believe is the slowest where it's almost guaranteed you will grow old an die before we kill you.
:unsure-1: ohh. I see. They should still kill them quicker, it would save them money wouldnt it :)
MattHughesRocks
01-15-2010, 07:27 PM
It would save money but seriously...where I live, people protest and weep uncontrollably when a flippin' tree is cut down :blink:
:unsure-1: ohh. I see. They should still kill them quicker, it would save them money wouldnt it :)
Bonnie
01-15-2010, 07:57 PM
That isn't an issue of the country is a State issue.Each one has their own laws.Texas, they get executed the fastest.California I believe is the slowest where it's almost guaranteed you will grow old an die before we kill you.
Slackards! :tongue0011:
Tyburn
01-15-2010, 08:01 PM
It would save money but seriously...where I live, people protest and weep uncontrollably when a flippin' tree is cut down :blink:
That is because they dont understand, because they are not shown.
The Executions should be public, and they should be well publicised, and they should be frequent...say...weekly :)
Executions were meant to draw spectators, thats part of their purpose..its not some dirty deed to be done in a maximum security prison, as if the State were doing something wrong...it should be...done in the light...as a spectical
Like we used to do. http://www.youtube.com/watch?v=C_sM86GnH7A
Dont you aggree sugarplum :huh:
MattHughesRocks
01-15-2010, 08:13 PM
Well that was dreadfully long :blink: I don't agree with a public death. I don't need to see it to know what's against the law and there is no way we can do the holiday thing each time if they did it as needed around here.We'd never get any work doneThat is because they dont understand, because they are not shown.
The Executions should be public, and they should be well publicised, and they should be frequent...say...weekly :)
Executions were meant to draw spectators, thats part of their purpose..its not some dirty deed to be done in a maximum security prison, as if the State were doing something wrong...it should be...done in the light...as a spectical
Like we used to do. http://www.youtube.com/watch?v=C_sM86GnH7A
Dont you aggree sugarplum :huh:
Tyburn
01-15-2010, 08:18 PM
Well that was dreadfully long :blink: I don't agree with a public death. I don't need to see it to know what's against the law and there is no way we can do the holiday thing each time if they did it as needed around here.We'd never get any work done
But it was fun to watch wasnt it Sugarplum :laugh:
Those bells you hear after the bit on "punch" are infact the bells of Saint Paul's Cathedral. Its litterally within sight distance from The Old Bailey. Infact the prison stretched from the Court House and backed onto the plot of ground where all the Clergy from the Cathedral live...and the Stock Exchange. :laugh:
also...did you notice, the two things to servive at the site of Tyburn were...1) a police Station...and 2) a big multiplex Cinema...thats soooooo ironic...you know Tyburn is not advertized period in London...its like...noone knows what happened for 600 years on that round-a-bout...you cant even see the River Tyburn anymore, as it flows underneith in a pipe now :ninja:
bradwright
01-15-2010, 11:27 PM
Well, we can't repay evil with evil. Jesus never did, so we're not allowed to either. Although I do understand how you feel, because I completely agree that every single one of them deserves to die for the profession that they have chosen. But that sentence is not ours to carry out, GOD will take care of that Himself.
The only way that the Pro-Choice movement gained as much power as it did is by changing the culture, which is what we have to do in order to get this country back to it's Christian roots.
The most effective way is for parents to train up their children to love GOD and to believe in the Bible. For those of us who don't have children, then we can help by making our beliefs publicly known and being completely unapologetic about those beliefs.
Also NEVER, NEVER, NEVER waiver or compromise those beliefs. Don't say, "I think abortion is wrong and shouldn't be allowed, unless......." All you need to say is "Abortion is always wrong and should never be allowed under any circumstances whatsoever." Don't cave in to the fallacious arguments involving rape, incest or the health of the mother. There are always other options available that don't require the murder of the child.
You might get harassed, insulted or even lose your job/family/etc.; but if you are not willing to risk discomfort, pain or death for your beliefs, then they are not really your beliefs.
while i agree with you on every other point i find it very difficult to agree with you on this one.
if the woman was pregnant and complications arose to the point that her life was in danger and aborting the baby
was the only way out then i dont think we have the right to say she has to give up her life to allow the baby to survive....i just dont see how we could judge someone in that situation.
Spiritwalker
01-16-2010, 12:09 AM
Nate.. you know I love ya dude... but..there are some contradictions I see below...
I am not slamming you.. I am looking for clarification...
Well, we can't repay evil with evil. Jesus never did, so we're not allowed to either.
- But aren't you pro-death penalty?
Also NEVER, NEVER, NEVER waiver or compromise those beliefs. Don't say, "I think abortion is wrong and shouldn't be allowed, unless......." All you need to say is "Abortion is always wrong and should never be allowed under any circumstances whatsoever." ..................
I understand where you are coming from.. I honestly do.. but when you see some of the babies that are born with "no brain"..or other horrid defects.. then is it not more "humane" and compassionate to the parents in some cases?
You might get harassed, insulted or even lose your job/family/etc.; but if you are not willing to risk discomfort, pain or death for your beliefs, then they are not really your beliefs.
While I completely agree with you on this point.. you should always listen to what they have to say.. at the very least.. "Know thine enemy"..
There is a difference between standing up for your convictions...and blindly following.. Strength of Will is great... Informed Strength of Will is better.
Agree?
Don't cave in to the fallacious arguments involving rape, incest or the health of the mother. There are always other options available that don't require the murder of the child.
Just to test your convictions.... Can you answer these questions?
1. So do you think "The Morning After Pill" is an option? Or would you consider that an abortion if in fact a child had been conceived?
2. Would you be in favor of some form of "license" to "get pregnant"? Blood screening and such?
3. So you get married.. the love of your life.. you are happy.. wonderful... "On Top of The World...." She gets in "a family way"... you go in for the first ultra sound... The doc gets silent... and later tells you and the love of your life.... "If you have this baby.. your wife is going to DIE.. no chance... "
50 other docs agree.. The light in her eyes is going to be gone, she will be cold and in the earth...
Your wife tells you.. "NateR.. I don't want to die.. please..."
God tells you... Your wife will die.
You still say no?
4. Would you agree that the knowledge that these doctors use is God given? If not, why would Satan want the souls of unborn babies.. surely these souls have a special place in the kingdom of Heaven.
Tyburn
01-17-2010, 12:38 AM
Just to test your convictions.... Can you answer these questions?
1. So do you think "The Morning After Pill" is an option? Or would you consider that an abortion if in fact a child had been conceived?
2. Would you be in favor of some form of "license" to "get pregnant"? Blood screening and such?
3. So you get married.. the love of your life.. you are happy.. wonderful... "On Top of The World...." She gets in "a family way"... you go in for the first ultra sound... The doc gets silent... and later tells you and the love of your life.... "If you have this baby.. your wife is going to DIE.. no chance... "
50 other docs agree.. The light in her eyes is going to be gone, she will be cold and in the earth...
Your wife tells you.. "NateR.. I don't want to die.. please..."
God tells you... Your wife will die.
You still say no?
4. Would you agree that the knowledge that these doctors use is God given? If not, why would Satan want the souls of unborn babies.. surely these souls have a special place in the kingdom of Heaven.
1) I would say that contraception is not abortion...but I would say the morning after pill was...its like you can shrugg your responsibilities off because you can take a pill and it can all go away. Thats just wrong IMHO
2) No liscence should be needed, thats just going to give way to another whole section of the black market isnt it :laugh: I think Babies should only be born inside of married couples though.
3) Are you really asking the question "who comes first, your GOD, or Your Wife" ??
Did Abraham choose his Son over GOD? Did the Lord chose HIS Son over YOU?
I dont think there is any question of the answer a Christian should give to this.
...but then I'm not married and probably never will be...perhaps I'd feel differently if I was married with a large family...I will conceed that point...but the facts still remain GOD< Wife :laugh:
I know you werent asking me...but I felt compelled to answer anyway :)
NateR
01-17-2010, 06:30 AM
- But aren't you pro-death penalty?
Yes, and that's completely unrelated.
There is a difference between standing up for your convictions...and blindly following.. Strength of Will is great... Informed Strength of Will is better.
I already understand the abortion point of view, since I was once pro-abortion.
Just to test your convictions.... Can you answer these questions?
1. So do you think "The Morning After Pill" is an option? Or would you consider that an abortion if in fact a child had been conceived?
2. Would you be in favor of some form of "license" to "get pregnant"? Blood screening and such?
3. So you get married.. the love of your life.. you are happy.. wonderful... "On Top of The World...." She gets in "a family way"... you go in for the first ultra sound... The doc gets silent... and later tells you and the love of your life.... "If you have this baby.. your wife is going to DIE.. no chance... "
50 other docs agree.. The light in her eyes is going to be gone, she will be cold and in the earth...
Your wife tells you.. "NateR.. I don't want to die.. please..."
God tells you... Your wife will die.
You still say no?
4. Would you agree that the knowledge that these doctors use is God given? If not, why would Satan want the souls of unborn babies.. surely these souls have a special place in the kingdom of Heaven.
1. If the egg is not fertilized, then there is no child, thus it is not an abortion. It's really quite simple. Contraception is completely unrelated to abortion.
2. Absolutely not! The government has no business telling people when they are allowed to procreate. Any form of government control over reproductive rights is hovering dangerously close to Eugenics and we already know the consequences of that.
3. Any woman who would kill her child in order to save her own life is not a woman I want to be married to. If GOD wants her to die then she'll die and we would just look forward to meeting again in Heaven.
4. I dont' really understand your point here. Just because someone is educated and intelligent doesn't mean that they are carrying out GOD's Will. The entire 20th century can attest to that. And do you really think that aborted babies go to Hell? :huh: That's nonsense.
NateR
01-17-2010, 07:04 AM
3) Are you really asking the question "who comes first, your GOD, or Your Wife" ??
Did Abraham choose his Son over GOD? Did the Lord chose HIS Son over YOU?
I dont think there is any question of the answer a Christian should give to this.
...but then I'm not married and probably never will be...perhaps I'd feel differently if I was married with a large family...I will conceed that point...but the facts still remain GOD< Wife :laugh:
I know you werent asking me...but I felt compelled to answer anyway :)
I think you meant to type GOD>Wife. :wink:
The Bible is very clear that anyone who puts their father, mother, son, daughter or spouse before GOD is not worthy of GOD.
So, I agree, theologically the decision is pretty clear. Emotionally, of course, it would be a very tough call to make and I wouldn't hold it against any couple who decided to go with the abortion in the circumstance that Spiritwalker describes. Not everyone has strong faith. But I would be praying for them when the realization of what they have done sets in.
However, I think that GOD > 50 doctors. In fact, GOD > 50 million doctors, so I would still put my faith in Him over our limited human intellects. Truth is not a democratic process, so 50 million doctors could still be wrong.
TexasRN
01-17-2010, 12:10 PM
I think you meant to type GOD>Wife. :wink:
The Bible is very clear that anyone who puts their father, mother, son, daughter or spouse before GOD is not worthy of GOD.
So, I agree, theologically the decision is pretty clear. Emotionally, of course, it would be a very tough call to make and I wouldn't hold it against any couple who decided to go with the abortion in the circumstance that Spiritwalker describes. Not everyone has strong faith. But I would be praying for them when the realization of what they have done sets in.
However, I think that GOD > 50 doctors. In fact, GOD > 50 million doctors, so I would still put my faith in Him over our limited human intellects. Truth is not a democratic process, so 50 million doctors could still be wrong.
Absolutely. I've seen several miracles like this myself in the 4 years I've worked with pregnant women. I've got a pt I see now who has a medical condition that should kill her with pregnancy (very rare clotting disorder) and she's now close to full term. She was told she should never get pregnant and after being married for a few years a child was conceived unintentionally on their part. She chose to continue the pregnancy, risking her life. We are planning to deliver her as soon as the baby's lungs are mature to keep her chances of living up. She should not have made it this long.
~Amy
mscomc
01-17-2010, 02:27 PM
Yes, and that's completely unrelated.
I already understand the abortion point of view, since I was once pro-abortion.
1. If the egg is not fertilized, then there is no child, thus it is not an abortion. It's really quite simple. Contraception is completely unrelated to abortion.
2. Absolutely not! The government has no business telling people when they are allowed to procreate. Any form of government control over reproductive rights is hovering dangerously close to Eugenics and we already know the consequences of that.
3. Any woman who would kill her child in order to save her own life is not a woman I want to be married to. If GOD wants her to die then she'll die and we would just look forward to meeting again in Heaven.
4. I dont' really understand your point here. Just because someone is educated and intelligent doesn't mean that they are carrying out GOD's Will. The entire 20th century can attest to that. And do you really think that aborted babies go to Hell? :huh: That's nonsense.
Ok, but where does that end then?
1) if you get an infection, do you not go to the doctor to take anti-virals, or antibiotics, or even just up the vitamin C intake? Couldn't you just say you are sick becasue God wants you to be sick?
2) Heaven forbid you are in an accident that involves heavy trauma, you are bleading none stop, and a banged up bad. are you saying people should just leave you there an not do anything to save you? Because if God wants you to die then you will die and vice versa.
...i think you get where im going with this. So when does it end? I mean, unless you are a christian scientist. are you?
Tyburn
01-17-2010, 02:28 PM
I think you meant to type GOD>Wife. :wink:
.
Oh Yes...you are correct. My bad :ashamed:
Neezar
01-17-2010, 02:30 PM
Absolutely. I've seen several miracles like this myself in the 4 years I've worked with pregnant women. I've got a pt I see now who has a medical condition that should kill her with pregnancy (very rare clotting disorder) and she's now close to full term. She was told she should never get pregnant and after being married for a few years a child was conceived unintentionally on their part. She chose to continue the pregnancy, risking her life. We are planning to deliver her as soon as the baby's lungs are mature to keep her chances of living up. She should not have made it this long.
~Amy
I have a clotting disorder and they didn't find out until I was 7 months pregnant. They told me they had to take the baby or we would both die. :unsure-1: The specialists said I would never live through my second pregnancy. Then they said I wouldn't make it through labor.
And against all odds, here I am, and here are my boys they said would never make it. :cool:
http://i69.photobucket.com/albums/i47/neezar086/boys/BotanicalGardens036.jpg
:w00t:
God has blessed me well. :wub:
Tyburn
01-17-2010, 02:31 PM
I mean, unless you are a christian scientist. are you?
:laugh: NO he is not :laugh: (well He's not a member of Christ Scientist, if thats what you are asking...they arent a true denomination of Christianity IMHO)
There is no problem in seeking medication, thats not against GODs law is it...however MURDER is. So its fine to use and trust Doctors...until they advocate something against GODs Law
Kill your baby...that would be against GODs law whether it is to save the Wife or not...You must let GOD handle situations in which using or doing something to doctors advise breaks a higher rule.
Tyburn
01-17-2010, 02:34 PM
I wouldn't hold it against any couple who decided to go with the abortion in the circumstance that Spiritwalker describes.
How come you wouldnt hold it against them....and yet you'd hold it against someone who aborts due to rape??
the truth is...there is NO decision to be made...wasnt it you who just said something about NEVER comprimsing your beliefs :huh:
Neezar
01-17-2010, 02:38 PM
3. So you get married.. the love of your life.. you are happy.. wonderful... "On Top of The World...." She gets in "a family way"... you go in for the first ultra sound... The doc gets silent... and later tells you and the love of your life.... "If you have this baby.. your wife is going to DIE.. no chance... "
50 other docs agree.. The light in her eyes is going to be gone, she will be cold and in the earth...
Your wife tells you.. "NateR.. I don't want to die.. please..."
God tells you... Your wife will die.
You still say no?
Well, I understand you are asking Nate in regards to his beliefs. But I would like to point out that we don't need abortion laws or abortion centers to handle these type situations. This falls under a totally different category when it comes to medical field. In other words, if this were the situation a doctor would NOT send you to an abortion clinic.
Neezar
01-17-2010, 02:45 PM
Here is an example of a situtation where it gets sticky for me:
A woman is pregnant in her tubes. That is a no win situation. The baby can NOT grow and survive there. It will get big enough to burst mom's tubes and cause problems for mom. She can die from that. It is technically a fetus. :unsure-1: Well, we had a woman in this situation who also had a pregnancy in her uterus and the tubal pregnancy was threatening the baby that was implanted in her uterus who would have a fighting chance if they removed the tubal pregnancy. Her and her husband were struggling with their spiritual beliefs and making a decision.
ps I won't even mention the fact that her religious beliefs would not allow her to recieve blood products and she was slowly bleeding out while trying to decide. :cry:
Spiritwalker
01-17-2010, 02:52 PM
Yes, and that's completely unrelated.
See I don't see it so completely unrelated. Death is Death.. murder is murder (yes there is self defense and military killings.. both THOSE are different).
why do you thing that abortion is horrid.. but you can be in favor of the death penalty.
I already understand the abortion point of view, since I was once pro-abortion.
ok, what is the "right to choose" point of view? Just trying to understand your thinking.
1. If the egg is not fertilized, then there is no child, thus it is not an abortion. It's really quite simple. Contraception is completely unrelated to abortion.
http://www.morningafterpill.org/catholic-teaching.html
The morning-after pill is a hormone-based preparation (it can contain oestrogens, oestrogen/progestogens or only progestogens) which, within and no later than 72 hours after a presumably fertile act of sexual intercourse, has a predominantly "anti-implantation" function, i.e., it prevents a possible fertilized ovum (which is a human embryo), by now in the blastocyst stage of its development (fifth to sixth day after fertilization), from being implanted in the uterine wall by a process of altering the wall itself. The final result will thus be the expulsion and loss of this embryo. Only if this pill were to be taken several days before the moment of ovulation could it sometimes act to prevent the latter (in this case it would function as a typical "contraceptive"). However, the woman who uses this kind of pill does so in the fear that she may be in her fertile period and therefore intends to cause the expulsion of a possible new conceptus; above all, it would be unrealistic to think that a woman, finding herself in the situation of wanting to use an emergency contraceptive, would be able to know exactly and opportunely her current state of fertility.
Sound like a VERY early term abortion to me... But that be splitting hairs to some...
2. Absolutely not! The government has no business telling people when they are allowed to procreate. Any form of government control over reproductive rights is hovering dangerously close to Eugenics and we already know the consequences of that.
OK.. so saying that abortion should be illeagle, would be wrong then? Of course we then start blending politics and religion.. which is only REALLY good.. or the other 99.9999999999% of the time.. really bad.
3. Any woman who would kill her child in order to save her own life is not a woman I want to be married to. If GOD wants her to die then she'll die and we would just look forward to meeting again in Heaven.
...... :mellow:
4. I dont' really understand your point here. Just because someone is educated and intelligent doesn't mean that they are carrying out GOD's Will. The entire 20th century can attest to that. And do you really think that aborted babies go to Hell? :huh: That's nonsense.
No I do not think that. But "The child who was never exposed to the knowledge of God".. where do they go when they die?
No what I wonder by the questions is the whole religion that says "no other blood".. no surgery..
I forget the name at this time...
"kid dies cause his appendix bursts...Docs could have saved him with a simple operation.. but the religion doesn't allow it. Isn't it possible that "God gave the knowledge on how to save this kids life".. and people have it wrong?
Spiritwalker
01-17-2010, 02:57 PM
Here is an example of a situtation where it gets sticky for me:
A woman is pregnant in her tubes. That is a no win situation. The baby can NOT grow and survive there. It will get big enough to burst mom's tubes and cause problems for mom. She can die from that. It is technically a fetus. :unsure-1: Well, we had a woman in this situation who also had a pregnancy in her uterus and the tubal pregnancy was threatening the baby that was implanted in her uterus who would have a fighting chance if they removed the tubal pregnancy. Her and her husband were struggling with their spiritual beliefs and making a decision.
ps I won't even mention the fact that her religious beliefs would not allow her to recieve blood products and she was slowly bleeding out while trying to decide. :cry:
IMO.. conception is a baby.. "fetus" is too clinical for me..
That would be a very difficult decision for some.. and depending on how far along the pregancy was.. It would be an easy choice for me..
Spiritwalker
01-17-2010, 03:00 PM
Well, I understand you are asking Nate in regards to his beliefs. But I would like to point out that we don't need abortion laws or abortion centers to handle these type situations. This falls under a totally different category when it comes to medical field. In other words, if this were the situation a doctor would NOT send you to an abortion clinic.
No, I think the doctor would send the woman to a clinic.. as in "get out of my office"...
But I would think that a doc would let you make an informed decision.. and then proceed in helping you with enacting the decision..
Spiritwalker
01-17-2010, 03:02 PM
wow.. very cool.. glad you were able to make a rocking decision.. and after everything going ok on the first.. you would have to think that they were wrong on the second as well... Same OBGYN?
I have a clotting disorder and they didn't find out until I was 7 months pregnant. They told me they had to take the baby or we would both die. :unsure-1: The specialists said I would never live through my second pregnancy. Then they said I wouldn't make it through labor.
And against all odds, here I am, and here are my boys they said would never make it. :cool:
http://i69.photobucket.com/albums/i47/neezar086/boys/BotanicalGardens036.jpg
:w00t:
God has blessed me well. :wub:
Tyburn
01-17-2010, 03:18 PM
See I don't see it so completely unrelated. Death is Death.. murder is murder (yes there is self defense and military killings.. both THOSE are different).
why do you thing that abortion is horrid.. but you can be in favor of the death penalty.
Its not the same at all. Capital Punishment is about Justice, AND its advocated in the Old Testament by GOD. So evidently GOD doesnt see Murder as being the same as the Death Penalty.
Murder is about committing a crime, Capital Punishment is the opposite, its about Restoration. How can you not understand that???
Answer me this: in a Capital Punishment case...WHO exactly is guilty of the execution? Is it the guy who pulls the lever,or presses the button? is it the Judge that handed down the order?
...or is it the criminal himself, who kills himself by default of his actions?
Neezar
01-17-2010, 03:19 PM
No, I think the doctor would send the woman to a clinic.. as in "get out of my office"...
But I would think that a doc would let you make an informed decision.. and then proceed in helping you with enacting the decision..
No way! My mind won't allow me to believe that a licensed doctor would send a patient to an abortion clinic if she medically needs to have a pregnancy terminated. Nope. Sorry. Can't accept it. :unsure-1:
Neezar
01-17-2010, 03:42 PM
wow.. very cool.. glad you were able to make a rocking decision.. and after everything going ok on the first.. you would have to think that they were wrong on the second as well... Same OBGYN?
Well everything didn't go okay with the first. :unsure-1: That is how they discovered my problem. I could write a book on what unfolded. Seriously. But long story short. I refused to let them (the specialists) take my baby. We (my regular OB doc and hubby and me) fired the specialists and decided to wing it on our own and we made it. :cool:
And, yes, same doc with second one. No way was I using someone else. I really thought he would try to get me to abort after what we went through with the first. He didn't. I love that man. Literally. Anyway, the second was an accident. We didn't think we could have kids and the first was a miracle baby so we never dreamed we would be pregnant again 9 months later. :unsure-1: oops. After the second, he said that I would have to get fixed or find a high risk doc because I was driving him to drinking. :laugh:
ps All I went through is what made me decide to go to nursing school. My nurse is the one that basically save me and my baby.:cool:
NateR
01-17-2010, 04:06 PM
Ok, but where does that end then?
1) if you get an infection, do you not go to the doctor to take anti-virals, or antibiotics, or even just up the vitamin C intake? Couldn't you just say you are sick becasue God wants you to be sick?
2) Heaven forbid you are in an accident that involves heavy trauma, you are bleading none stop, and a banged up bad. are you saying people should just leave you there an not do anything to save you? Because if God wants you to die then you will die and vice versa.
...i think you get where im going with this. So when does it end? I mean, unless you are a christian scientist. are you?
You are confusing the issue with unrelated hypothetical situations. In neither of those instances that you present would I be required to take someone else's life in order to become healthy again.
NateR
01-17-2010, 04:12 PM
See I don't see it so completely unrelated. Death is Death.. murder is murder (yes there is self defense and military killings.. both THOSE are different).
why do you thing that abortion is horrid.. but you can be in favor of the death penalty.
Are you seriously unable to comprehend this? :huh: Really? I have a hard time believing that you actually think these are the same issue.
Ridding the world of a murderer who has killed and WILL kill again given the opportunity; is the same as killing a defenseless, unborn child who has done NOTHING but present an inconvenience?
You can't possible have trouble comprehending the difference here. You're smarter than that.
NateR
01-17-2010, 04:25 PM
ok, what is the "right to choose" point of view? Just trying to understand your thinking.
The whole "Freedom of Choice" argument is a joke. In truth, it is actually the "Freedom to take away someone else's freedom of choice." Since the baby's human rights are never even considered when it comes to abortion.
http://www.morningafterpill.org/catholic-teaching.html
The morning-after pill is a hormone-based preparation (it can contain oestrogens, oestrogen/progestogens or only progestogens) which, within and no later than 72 hours after a presumably fertile act of sexual intercourse, has a predominantly "anti-implantation" function, i.e., it prevents a possible fertilized ovum (which is a human embryo), by now in the blastocyst stage of its development (fifth to sixth day after fertilization), from being implanted in the uterine wall by a process of altering the wall itself. The final result will thus be the expulsion and loss of this embryo. Only if this pill were to be taken several days before the moment of ovulation could it sometimes act to prevent the latter (in this case it would function as a typical "contraceptive"). However, the woman who uses this kind of pill does so in the fear that she may be in her fertile period and therefore intends to cause the expulsion of a possible new conceptus; above all, it would be unrealistic to think that a woman, finding herself in the situation of wanting to use an emergency contraceptive, would be able to know exactly and opportunely her current state of fertility.
Sound like a VERY early term abortion to me... But that be splitting hairs to some...
I've heard that the pill doesn't work if you are already pregnant. So, as long as it prevent the egg from being fertilized, then it is contraception, not abortion. Take a Biology class and you'll understand the difference a little better.
OK.. so saying that abortion should be illeagle, would be wrong then? Of course we then start blending politics and religion.. which is only REALLY good.. or the other 99.9999999999% of the time.. really bad.
I've said nothing about religion. The Bible tells us not to murder or steal. Does that mean that we need to take laws against theft and murder off of our books in order to propagate this myth of "Separation of Church and State?"
...... :mellow:
It's called trusting in GOD no matter what the circumstances and praising GOD even in the midst of tragedy.
No I do not think that. But "The child who was never exposed to the knowledge of God".. where do they go when they die?
No what I wonder by the questions is the whole religion that says "no other blood".. no surgery..
I believe that children who die before a certain age would go to Heaven, since they are mentally incapable of understanding the consequences of their actions or distinguishing right from wrong. So I believe that an aborted baby would go to Heaven as well.
I forget the name at this time...
"kid dies cause his appendix bursts...Docs could have saved him with a simple operation.. but the religion doesn't allow it. Isn't it possible that "God gave the knowledge on how to save this kids life".. and people have it wrong?
Again, this is confusing the issue with unrelated scenarios. No one would have had to lose their life in order for that kid's appendix to be removed.
mscomc
01-17-2010, 04:48 PM
You are confusing the issue with unrelated hypothetical situations. In neither of those instances that you present would I be required to take someone else's life in order to become healthy again.
No no, i think you've misunderstood where im coming from. I'm not talking about taking life here. Im simpling reffering to God's will. In the pregnancy scenario, you stated that a woman should not abort even if her life is in jeopardy, if God wants her to die, then she will. Im really focussing on the "God wants" part. It just happend in this case it involved death.
What I am saying is, if God would want the woman to die in THAT case, then what about in other "simpler" cases, such as common cold where you seek treatment, or if you were to suffer some kind of ilness that you sought treatment for. Are you not going against Gods will in that case as well? Does he not want you to be sick, if you are sick? so shouldnt you just stay sick and see what happens?
NateR
01-17-2010, 06:09 PM
No no, i think you've misunderstood where im coming from. I'm not talking about taking life here. Im simpling reffering to God's will. In the pregnancy scenario, you stated that a woman should not abort even if her life is in jeopardy, if God wants her to die, then she will. Im really focussing on the "God wants" part. It just happend in this case it involved death.
What I am saying is, if God would want the woman to die in THAT case, then what about in other "simpler" cases, such as common cold where you seek treatment, or if you were to suffer some kind of ilness that you sought treatment for. Are you not going against Gods will in that case as well? Does he not want you to be sick, if you are sick? so shouldnt you just stay sick and see what happens?
That's up to the individual person to determine how much healthcare they want to expose themselves to and how much they want to put in GOD's hands.
However, the line should be drawn at taking a life in order to save your own life. That's what this specific abortion scenario is about. If I had heart disease, I wouldn't be allowed to kill my own son so I could harvest his healthy heart. So, in the same manner, a mother should not be allowed to kill her child to save her own life.
It's really quite simple to understand. People just make it complicated in order to try to cover up the truth that abortion is murder.
bradwright
01-17-2010, 06:16 PM
That's up to the individual person to determine how much healthcare they want to expose themselves to and how much they want to put in GOD's hands.
However, the line should be drawn at taking a life in order to save your own life. That's what this specific abortion scenario is about. If I had heart disease, I wouldn't be allowed to kill my own son so I could harvest his healthy heart. So, in the same manner, a mother should not be allowed to kill her child to save her own life.
It's really quite simple to understand. People just make it complicated in order to try to cover up the truth that abortion is murder.
its easy to have your point of view when you know you personally will never have to face a situation like that.
NateR
01-17-2010, 06:23 PM
its easy to have your point of view when you know you personally will never have to face a situation like that.
That's irrelevant to the topic. Truth doesn't change based on our circumstances.
Tyburn
01-17-2010, 06:26 PM
its easy to have your point of view when you know you personally will never have to face a situation like that.
The point that I think Nathan is trying to make is that this isnt a case of his point of view...and its not always a case of doing what he wants to do.
In the case of Murder...the Bible is VERY clear. You must NOT deliberately take the life of someone else. The Exceptions are self defense, where essentially its not a desire to kill someone else, but you might do that to protect yourself or others from people who would (hence the Military) OR where Justice calls for the State to carry out the punishment...in this case, the Murder is actually caused by the person who is killed, because they committed a crime, knowing full well what the consequences were.
So Nathan isnt really telling you what he would WANT to do. He is telling you what GOD commands be done...and I have no doubt that he would follow those Orders no matter what personal cost to him it took...I'm also reasonably sure, if he ever got Married, SHE would feel the same way. She would probably also Love GOD, and would also not want to break his commands. She would be alright with it. She would have no problem sacrificing herself, for her Childs sake....because she would Love her Child and she would do anything to protect it...Even Die.
bradwright
01-17-2010, 06:29 PM
That's irrelevant to the topic. Truth doesn't change based on our circumstances.
its only irrelevant to the topic in your eyes...not to someone that would actually find themselves in a situation like that.
so let me see if i understand your point of view here....you are telling me that no one has the right to take another life just to save their own ?
bradwright
01-17-2010, 06:50 PM
The point that I think Nathan is trying to make is that this isnt a case of his point of view...and its not always a case of doing what he wants to do.
In the case of Murder...the Bible is VERY clear. You must NOT deliberately take the life of someone else. The Exceptions are self defense, where essentially its not a desire to kill someone else, but you might do that to protect yourself or others from people who would (hence the Military) OR where Justice calls for the State to carry out the punishment...in this case, the Murder is actually caused by the person who is killed, because they committed a crime, knowing full well what the consequences were.
So Nathan isnt really telling you what he would WANT to do. He is telling you what GOD commands be done...and I have no doubt that he would follow those Orders no matter what personal cost to him it took...I'm also reasonably sure, if he ever got Married, SHE would feel the same way. She would probably also Love GOD, and would also not want to break his commands. She would be alright with it. She would have no problem sacrificing herself, for her Childs sake....because she would Love her Child and she would do anything to protect it...Even Die.
the point i'm trying to make here Dave is God commands us to not do a lot of things and if we choose to ignore him and do them anyway then we are committing a sin.... so tell me why would a woman deciding to abort her pregnancy because her life was in danger be any worse then all the rest of the sins that we all commit everyday?... because according to you and some others here God views all sins as being equal....just wondering.
NateR
01-17-2010, 07:09 PM
its only irrelevant to the topic in your eyes...not to someone that would actually find themselves in a situation like that.
so let me see if i understand your point of view here....you are telling me that no one has the right to take another life just to save their own ?
So, that woman who drowned her own children in the bathtub years ago. Do you believe that since I'm not a woman and have never been a parent, then I'm not allowed to look at that situation and say, "What that woman did was wrong"?
Also, you are trying to cloud the issue. A woman who decides to kill her own baby to save her life based on the OPINIONS of one or more doctors (doctors are still just human beings, they can't predict the future) is a completely different situation compared to something like killing someone on the battlefield who is actively trying to kill you. Or killing a burglar in your home who is posing a direct threat to your family.
The main difference is that the unborn baby is not intentionally trying to harm anyone. It has no malice towards the mother who is being put in danger. Thus killing the baby is wrong.
The root of our misunderstanding is one of perspective. You seem to be focused solely on the mother, but I am focused on the baby AND the mother. There are two human beings involved in every abortion, but usually only one of them is going to come out of it alive. I'm more worried about the one who has no chance to defend itself, versus the one who is only thinking about herself.
bradwright
01-17-2010, 07:18 PM
So, that woman who drowned her own children in the bathtub years ago. Do you believe that since I'm not a woman and have never been a parent, then I'm not allowed to look at that situation and say, "What that woman did was wrong"?
Also, you are trying to cloud the issue. A woman who decides to kill her own baby to save her life based on the OPINIONS of one or more doctors (doctors are still just human beings, they can't predict the future) is a completely different situation compared to something like killing someone on the battlefield who is actively trying to kill you. Or killing a burglar in your home who is posing a direct threat to your family.
The main difference is that the unborn baby is not intentionally trying to harm anyone. It has no malice towards the mother who is being put in danger. Thus killing the baby is wrong.
The root of our misunderstanding is one of perspective. You seem to be focused solely on the mother, but I am focused on the baby AND the mother. There are two human beings involved in every abortion, but usually only one of them is going to come out of it alive. I'm more worried about the one who has no chance to defend itself, versus the one who is only thinking about herself.
i understand completely what you are saying and i agree with you..all i'm trying to point out here is to judge a woman that decides to abort her pregnancy because her life is in danger is just wrong because neither you or I could possibly understand what that situation would be like to go through.
NateR
01-17-2010, 07:49 PM
i understand completely what you are saying and i agree with you..all i'm trying to point out here is to judge a woman that decides to abort her pregnancy because her life is in danger is just wrong because neither you or I could possibly understand what that situation would be like to go through.
Well, I already stated in a previous post that I wouldn't hold it against a married couple who decided to go with the abortion out of fear. That's something that they must live with. However, Spiritwalker asked what I would do if my (fictional) wife was in that situation. So I stated my beliefs and convictions on that situation and I would make sure to only marry a woman who held those same convictions.
bradwright
01-17-2010, 08:14 PM
Well, I already stated in a previous post that I wouldn't hold it against a married couple who decided to go with the abortion out of fear. That's something that they must live with. However, Spiritwalker asked what I would do if my (fictional) wife was in that situation. So I stated my beliefs and convictions on that situation and I would make sure to only marry a woman who held those same convictions.
well Nate when you marry and you and your wife decide to have kids i hope you all the best but if for some reason she encounters problems with a pregnancy and her life is in jeopardy dont be surprised if she decides to abort because she can say what ever she wants before the fact but when faced with the possibility of losing her life she may change her mind.
NateR
01-17-2010, 09:21 PM
well Nate when you marry and you and your wife decide to have kids i hope you all the best but if for some reason she encounters problems with a pregnancy and her life is in jeopardy dont be surprised if she decides to abort because she can say what ever she wants before the fact but when faced with the possibility of losing her life she may change her mind.
I'd probably just shoot her myself if she did that. :wink:
Anyways, thanks for wishing something like that on me. :blink:
Tyburn
01-17-2010, 09:49 PM
so tell me why would a woman deciding to abort her pregnancy because her life was in danger be any worse then all the rest of the sins that we all commit everyday?... .
She wouldnt.
But why would you want to deliberately sin. People Sin by accident all the time...but deliberatley meaning to, and deliberately and knowingly doing something that would hurt the One who you Love?
Why would you want to hurt GOD? why would you want to upset him? why would you want to disrespect him? dont you trust him? Dont you know him better then that?
GOD gives free will. But he also tells you what is right and wrong. You are going to fall short...but that doesnt mean you may aswell committ other sins aswell. He tells you how he best perceives you love him. You can show your love by doing what he says. This will please him, it will make him happy.
You should care more about GOD then your Wife...she is mortal, and she will die, she cant save you niether. He reigns forever, He can look after he when she dies, and he can save you also. Plus...like I said...a Mother loves her Child, she wont be thinking selfish thoughts when her life is indanger, she will be thinking, and hoping for her Kid before herself. Especially if she is Christian.
GOD puts it best in my most favourite old testament passage. Read it outloud to yourself Brad...actually read it outloud.
This day I call heaven and earth as witnesses against you that I have set before you life and death, blessings and curses. Now choose life, so that you and your children may live
NateR
01-17-2010, 10:12 PM
the point i'm trying to make here Dave is God commands us to not do a lot of things and if we choose to ignore him and do them anyway then we are committing a sin.... so tell me why would a woman deciding to abort her pregnancy because her life was in danger be any worse then all the rest of the sins that we all commit everyday?... because according to you and some others here God views all sins as being equal....just wondering.
While it's true that all sins are equal in the eyes of GOD, the consequences of sin are most definitely not equal. Do you commit murder everyday? Because that's what abortion is.
After the abortion, the baby is dead and is not coming back and the woman has to live with the realization that she has murdered her own child for the rest of her life. The emotional and even physical scars of abortion will never go away.
Tell me, what sins are YOU committing everyday that compare to that? :huh:
Tyburn
01-17-2010, 10:16 PM
While it's true that all sins are equal in the eyes of GOD, the consequences of sin are most definitely not equal.
I would concure with that...in the temporal state different sins mean different repuccussions in the physical...and not all of them just a matter of legal law...you know...you steal you go to prison, you murder you get executed...but also like...you lie to someone...you lose their trust...you engage in forbidden sexual activities...you could get a disease.
So different sins have different consequences in the temporal world, on the physical...but none of those effect the Spiritual...in which all sin is seen as sin, and all sin equates to death, unless you are protected by Christ
Spiritwalker
01-17-2010, 10:40 PM
Its not the same at all. Capital Punishment is about Justice, AND its advocated in the Old Testament by GOD. So evidently GOD doesnt see Murder as being the same as the Death Penalty.
Murder is about committing a crime, Capital Punishment is the opposite, its about Restoration. How can you not understand that???
I never said I didn't. I am only asking questions
Answer me this: in a Capital Punishment case...WHO exactly is guilty of the execution? Is it the guy who pulls the lever,or presses the button? is it the Judge that handed down the order?
...or is it the criminal himself, who kills himself by default of his actions?
According to some... Society for placing the criminal in the position to take a life...
And don't forget about the jury in the trial...
Spiritwalker
01-17-2010, 10:42 PM
No way! My mind won't allow me to believe that a licensed doctor would send a patient to an abortion clinic if she medically needs to have a pregnancy terminated. Nope. Sorry. Can't accept it. :unsure-1:
No.. sorry.. mistype.. I should have typed WOULDN'T.. sorry.. the second sentence should point to the error.
Tyburn
01-17-2010, 10:42 PM
According to some... Society for placing the criminal in the position to take a life...
And don't forget about the jury in the trial...
Society doesnt place anyone in the position to do anything but follow a bunch of rules...most of them to prevent Trial...in the way your useing the word, Society doesnt even intriniscally exist to take blame...WHO is Society exactly?
Spiritwalker
01-17-2010, 10:58 PM
Are you seriously unable to comprehend this? :huh: Really? I have a hard time believing that you actually think these are the same issue.
Ridding the world of a murderer who has killed and WILL kill again given the opportunity; is the same as killing a defenseless, unborn child who has done NOTHING but present an inconvenience?
When you "get down to it" .. life is life.
I don't believe it actually myself.. but this is what many people believe..
Tyburn
01-17-2010, 11:01 PM
When you "get down to it" .. life is life.
I don't believe it actually myself.. but this is what many people believe..
If you dont believe it, why are you arguing it? Are you just trying to cause a stir :huh:
Spiritwalker
01-17-2010, 11:18 PM
The whole "Freedom of Choice" argument is a joke. In truth, it is actually the "Freedom to take away someone else's freedom of choice." Since the baby's human rights are never even considered when it comes to abortion.
I do agree with a LARGE part of that..
I've heard that the pill doesn't work if you are already pregnant. So, as long as it prevent the egg from being fertilized, then it is contraception, not abortion. Take a Biology class and you'll understand the difference a little better.
Define being pregnant then.. If an egg is fertilized, is that pregnant? Or is it when a fertilized egg settles into the uterine wall? Because if it's a "baby" when the egg is fertilized.. then the morning after pill IS (in many cases) an abortion. At the very least by altering the uterine wall and making it "hostile' to the egg.
And Nate.... I don't know your complete history.. assuming I wouldn't know about biology would be a mistake.
My favorite classes in high school was biology.. I have continued my own learning informally...when I had various issues that made me want to learn.
I've said nothing about religion. The Bible tells us not to murder or steal. Does that mean that we need to take laws against theft and murder off of our books in order to propagate this myth of "Separation of Church and State?"
Fair Enough.. I was thinking that your views on abortion were religiously driven.
It's called trusting in GOD no matter what the circumstances and praising GOD even in the midst of tragedy.
ok, fair enough.. that would be another thread... I have been told I was a cold man in the past.. but going by what you said.. you make me look like a wuss...
I believe that children who die before a certain age would go to Heaven, since they are mentally incapable of understanding the consequences of their actions or distinguishing right from wrong. So I believe that an aborted baby would go to Heaven as well.
ok, works for me. Thanks.
Again, this is confusing the issue with unrelated scenarios. No one would have had to lose their life in order for that kid's appendix to be removed.
Not confusing.. just trying to bring other aspects into the conversation..
Spiritwalker
01-17-2010, 11:24 PM
That's irrelevant to the topic. Truth doesn't change based on our circumstances.
But individual "truth" is based on experience.
Ask most 4 year olds about Santa.. Then ask the same kid... 6 years later..
Do you have kids Nate? I do.. holding my own kid put me where I am now...
That changed my truth.
I have held others newborns.. holding your own child changes EVERYTHING,
Spiritwalker
01-17-2010, 11:28 PM
If you dont believe it, why are you arguing it? Are you just trying to cause a stir :huh:
A "stir".... it's called a conversation.... get over it.
bradwright
01-18-2010, 02:13 AM
I'd probably just shoot her myself if she did that. :wink:
Anyways, thanks for wishing something like that on me. :blink:
Sorry about that Nate,i should have never said that...i really do wish you all the best as you go forward in life...i was just trying to get you to see it from my point of view is all....sometimes i just dont think before i type...didn't mean any harm.
bradwright
01-18-2010, 02:29 AM
She wouldnt.
But why would you want to deliberately sin. People Sin by accident all the time...but deliberatley meaning to, and deliberately and knowingly doing something that would hurt the One who you Love?
Why would you want to hurt GOD? why would you want to upset him? why would you want to disrespect him? dont you trust him? Dont you know him better then that?
GOD gives free will. But he also tells you what is right and wrong. You are going to fall short...but that doesnt mean you may aswell committ other sins aswell. He tells you how he best perceives you love him. You can show your love by doing what he says. This will please him, it will make him happy.
You should care more about GOD then your Wife...she is mortal, and she will die, she cant save you niether. He reigns forever, He can look after he when she dies, and he can save you also. Plus...like I said...a Mother loves her Child, she wont be thinking selfish thoughts when her life is indanger, she will be thinking, and hoping for her Kid before herself. Especially if she is Christian.
GOD puts it best in my most favourite old testament passage. Read it outloud to yourself Brad...actually read it outloud.
This day I call heaven and earth as witnesses against you that I have set before you life and death, blessings and curses. Now choose life, so that you and your children may live
people deliberately sin every day Dave...you may not but most do because some of the things they do they consider small sins...but a sin is a sin.
as for you saying i should care more about God then my wife...well i dont..i put my family first then God...i know you think i'm a complete idiot for that but for me thats just the way it is....you see Dave i already know my fate is sealed for the things i have done in my past and i have made my peace with that.
as far as the abortion issue go's i really am against it,i just cant bring myself to judge someone who decides to abort a pregnancy because their life is in danger if they dont...i just dont see how its my place what so ever to do so.
Tyburn
01-18-2010, 10:46 AM
people deliberately sin every day Dave...you may not but most do because some of the things they do they consider small sins...but a sin is a sin.
as for you saying i should care more about God then my wife...well i dont..i put my family first then God...i know you think i'm a complete idiot for that but for me thats just the way it is....you see Dave i already know my fate is sealed for the things i have done in my past and i have made my peace with that.
as far as the abortion issue go's i really am against it,i just cant bring myself to judge someone who decides to abort a pregnancy because their life is in danger if they dont...i just dont see how its my place what so ever to do so.
Dont make it a self fulfilling prophecy Brad. Whatever you have done in the past...the only person who can seal your fate is yourself. If you want to go to Hell...then GOD will not stop you. You just need to die without his indwelling Spirit and then you will be condemned.
OR you can go to him and you can appologise for whatever you have done that you feel was wrong. You can tell him that because of it, you know you dont deserve His forgiveness, or His Protection. But the beauty of it is...he will extend it to you anyway...because he PROMISES to forgive those who are really and honnestly sorry.]
Your not at peace...you've resigned yourself to a fate because you feel that you deserve it...and actually, your right...you do deserve it. BUT GOD is willing to tell you that it doesnt matter...that your love for him, and that you eagerness to please and to serve...and because you came to him and said how sorry you were...and how you wanted him to help you...and you dont need to lie to him...you can say "look, I know its not right, but I love my Wife and my Family more then you...please help me to understand" and he will change you if you are open.
The Choice remains in your hands Brad...its up to you. Once again:
This day I call heaven and earth as witnesses against you that I have set before you life and death, blessings and curses. Now choose life, so that you and your children may live
Neezar
01-18-2010, 06:05 PM
as far as the abortion issue go's i really am against it,i just cant bring myself to judge someone who decides to abort a pregnancy because their life is in danger if they dont...i just dont see how its my place what so ever to do so.
I couldn't/wouldn't either. Even though I was in that situation and chose the baby over myself, I can't really say what I would have done if I had been like 6 wks pregnant and faced the same situation. And I would never try to judge a family for their decision.
Spiritwalker
01-19-2010, 02:17 AM
I couldn't/wouldn't either. Even though I was in that situation and chose the baby over myself, I can't really say what I would have done if I had been like 6 wks pregnant and faced the same situation. And I would never try to judge a family for their decision.
6 weeks.. vs 7 months is a HUGE difference...
6 weeks.. vs 7 months is a HUGE difference...
Maybe for you. Not for me. Pregnant is pregnant. What is the difference anyway?
mscomc
01-19-2010, 11:43 PM
6 weeks.. vs 7 months is a HUGE difference...
Thats an interesting point you bring up (i assume you mean the physiological difference). I remember reading an article/survey in an undergrad psych elective I took that was talking about women who were considering abortion due to threat of their own life. They said if they were ever in that situation, they said they would NOT do it if they thought the fetus/baby could feel pain...some justified that as "if it can't sense anything yet, then it isnt a person yet".
Along the same time the American Medical Assocation began to study this. In their 2005 paper (http://jama.ama-assn.org/cgi/content/short/294/8/947) they showed that since thalamocortical fibers dont form until 23-30 weeks, the fetus cant functionally process pain. As far as I know, this has not been refuted, and subsequent studies have only confirmed these findings.
There was that video some of you may know of, "the silent scream" that showed footage of a 12 week old embryo moving while the procedure was being done on it. But this was refuted (even by some pro-life docs if i recall) because withdrawal reflexes to invasive procedures do not prove the existence of fetal pain, because those same responses can be elicited by nonpainful stimuli and occur without conscious cortical processing.
------ How does that change the debate? Im not sure, but just some info I thought you may like to know.
NateR
01-19-2010, 11:53 PM
Thats an interesting point you bring up (i assume you mean the physiological difference). I remember reading an article/survey in an undergrad psych elective I took that was talking about women who were considering abortion due to threat of their own life. They said if they were ever in that situation, they said they would NOT do it if they thought the fetus/baby could feel pain...some justified that as "if it can't sense anything yet, then it isnt a person yet".
Along the same time the American Medical Assocation began to study this. In their 2005 paper (http://jama.ama-assn.org/cgi/content/short/294/8/947) they showed that since thalamocortical fibers dont form until 23-30 weeks, the fetus cant functionally process pain. As far as I know, this has not been refuted, and subsequent studies have only confirmed these findings.
There was that video some of you may know of, "the silent scream" that showed footage of a 12 week old embryo moving while the procedure was being done on it. But this was refuted (even by some pro-life docs if i recall) because withdrawal reflexes to invasive procedures do not prove the existence of fetal pain, because those same responses can be elicited by nonpainful stimuli and occur without conscious cortical processing.
------ How does that change the debate? Im not sure, but just some info I thought you may like to know.:)
Yeah, it's not really about the baby feeling pain. It's about the baby being robbed of the gift of life for no good reason.
mscomc
01-19-2010, 11:55 PM
Yeah, it's not really about the baby feeling pain. It's about the baby being robbed of the gift of life for no good reason.
I think that part is subjective my friend. There are many reasons people will give, but you have your views, and others have theirs.
Spiritwalker
01-20-2010, 12:35 AM
Maybe for you. Not for me. Pregnant is pregnant. What is the difference anyway?
Well...
Is being pregnant conception?
Is being pregnant when the fertilized settles in the uterian wall?
For me I think I look at this slightly different... I consider pregnant (granted.. I will probably never resolve to to 100%) to be at the end of the embryo stage.. most people consider this the end of the first trimester.
Once you get into the fetal development stage (second trimester).. that's when I start having REAL issues with abortion... Honestly I have issues all the way around....
a 6 week fetus.. is not really recognizable, don't have most of the pathways built, skeletal structure.. and such...
where as 7 months.. most babies could survive outside of the mothers body.
There is much more to it of course, but that is a good starting point.
Spiritwalker
01-20-2010, 12:43 AM
Thats an interesting point you bring up (i assume you mean the physiological difference). I remember reading an article/survey in an undergrad psych elective I took that was talking about women who were considering abortion due to threat of their own life. They said if they were ever in that situation, they said they would NOT do it if they thought the fetus/baby could feel pain...some justified that as "if it can't sense anything yet, then it isnt a person yet".
Along the same time the American Medical Assocation began to study this. In their 2005 paper (http://jama.ama-assn.org/cgi/content/short/294/8/947) they showed that since thalamocortical fibers dont form until 23-30 weeks, the fetus cant functionally process pain. As far as I know, this has not been refuted, and subsequent studies have only confirmed these findings.
There was that video some of you may know of, "the silent scream" that showed footage of a 12 week old embryo moving while the procedure was being done on it. But this was refuted (even by some pro-life docs if i recall) because withdrawal reflexes to invasive procedures do not prove the existence of fetal pain, because those same responses can be elicited by nonpainful stimuli and occur without conscious cortical processing.
------ How does that change the debate? Im not sure, but just some info I thought you may like to know.
That makes it even more difficult. The phrase "functionally process pain".. is hiding behind words... But that is also part of the problem with science.. and ironically.. religion.... so much can't be proven.. and just has to be believed.
mscomc
01-20-2010, 01:07 AM
That makes it even more difficult. The phrase "functionally process pain".. is hiding behind words... But that is also part of the problem with science.. and ironically.. religion.... so much can't be proven.. and just has to be believed.
Oh sorry, my bad, maybe i should have explained that better. If you read the whole paper, and scientific review of that paper (i didnt post a link)...by functional pain, they are trying to reffer the to pain you and I feel as a comparison. In this research, they are saying that since a fetus before 20 weeks doesnt have this critical part of the brain, it cant feel that pain.
A way you could look at is:
---- there is a road, and at the end of the road, is your house. The road represents you nervous system, and the house is the pain center of the brain. When you are hurt, the impule goes up the "road" and eventually to the brain/house where it is 'processed' and you respond. But, in the case of the 20 week old (or less), its like the 'house' isnt built yet, so no pain. Im sorry if I am being patronizing.
Well...
Is being pregnant conception?
Is being pregnant when the fertilized settles in the uterian wall?
For me I think I look at this slightly different... I consider pregnant (granted.. I will probably never resolve to to 100%) to be at the end of the embryo stage.. most people consider this the end of the first trimester.
Once you get into the fetal development stage (second trimester).. that's when I start having REAL issues with abortion... Honestly I have issues all the way around....
a 6 week fetus.. is not really recognizable, don't have most of the pathways built, skeletal structure.. and such...
where as 7 months.. most babies could survive outside of the mothers body.
There is much more to it of course, but that is a good starting point.
So how old does a baby have to be for it to be murder?
Buzzard
01-20-2010, 02:23 AM
So how old does a baby have to be for it to be murder?
Since abortion is legal, it's not murder by the standards in place by our laws. Just like the argument that some on this forum have used saying that since the death penalty is legal, it isn't murder.
NateR
01-20-2010, 02:46 AM
Well...
Is being pregnant conception?
Is being pregnant when the fertilized settles in the uterian wall?
For me I think I look at this slightly different... I consider pregnant (granted.. I will probably never resolve to to 100%) to be at the end of the embryo stage.. most people consider this the end of the first trimester.
Once you get into the fetal development stage (second trimester).. that's when I start having REAL issues with abortion... Honestly I have issues all the way around....
a 6 week fetus.. is not really recognizable, don't have most of the pathways built, skeletal structure.. and such...
where as 7 months.. most babies could survive outside of the mothers body.
There is much more to it of course, but that is a good starting point.
If you want a quantifiable standard of measurement for when life begins, then the closest thing we have right now is DNA. A sperm and an egg are haploid cells, which means that they each only contain half of the genetic information necessary to make a human being. As soon as the sperm fertilizes the egg, those two half strands make a whole DNA strand. Thus, creating a completely new and unique human being with its own DNA that is separate from the mother.
The important factor to consider here is that the DNA strand created contains 100% of the information necessary for that single cell to form into a full grown adult. No new genetic information will be added to that person's DNA in their lifetime. Information will be lost, but not added.
So, using our current knowledge of genetics, it can be said to be a scientific fact that life begins at the moment of conception. Every other standard of "humanness" is subjective.
Buzzard
01-20-2010, 05:53 AM
If you want a quantifiable standard of measurement for when life begins, then the closest thing we have right now is DNA. A sperm and an egg are haploid cells, which means that they each only contain half of the genetic information necessary to make a human being. As soon as the sperm fertilizes the egg, those two half strands make a whole DNA strand. Thus, creating a completely new and unique human being with its own DNA that is separate from the mother.
The important factor to consider here is that the DNA strand created contains 100% of the information necessary for that single cell to form into a full grown adult. No new genetic information will be added to that person's DNA in their lifetime. Information will be lost, but not added.
So, using our current knowledge of genetics, it can be said to be a scientific fact that life begins at the moment of conception. Every other standard of "humanness" is subjective.
I disagree. The sperm which fertilizes the egg is already alive; so life was already there, thus not beginning at the moment of conception. A new individual life could be said to begin at the moment of conception, but not life itself. I believe that is what you meant by your statement. Am I correct? Sorry to split hairs, but that hair needed to be split.:wink:
NateR
01-20-2010, 06:33 AM
A new individual life could be said to begin at the moment of conception, but not life itself.
Yes, the sperm and the egg are alive, but they are products of the parent's bodies. When the sperm and the egg meet, then a new DNA strand is created that is related to the DNA from the mother and father, but is also a completely unique, individual DNA strand.
If we use DNA as a quantifiable standard for life, then that life begins at the moment of conception. Because all the information necessary for that person to live out their life is in place immediately after fertilization. Nothing else happens during the pregnancy to add more DNA information to the embryo.
Spiritwalker
01-20-2010, 10:04 AM
If you want a quantifiable standard of measurement for when life begins, then the closest thing we have right now is DNA. A sperm and an egg are haploid cells, which means that they each only contain half of the genetic information necessary to make a human being. As soon as the sperm fertilizes the egg, those two half strands make a whole DNA strand. Thus, creating a completely new and unique human being with its own DNA that is separate from the mother.
The important factor to consider here is that the DNA strand created contains 100% of the information necessary for that single cell to form into a full grown adult. No new genetic information will be added to that person's DNA in their lifetime. Information will be lost, but not added.
So, using our current knowledge of genetics, it can be said to be a scientific fact that life begins at the moment of conception. Every other standard of "humanness" is subjective.
Using that as your guideline, then "the morning after pill", would be an abortion, if the egg had become fertilized which I would belive is very common.
Spiritwalker
01-20-2010, 10:08 AM
So how old does a baby have to be for it to be murder?
The whole .."taking air into their lungs" is garabage..
20 years ago I would have said.. when the fetus can live without the mother.. but I don't belive that anymore..
After seeing my 2 kids ultrasounds.. it's a very hard question...
I am leaning towards before the first 6 weeks. It's more of a "blob" still.. And again, I would be willing to change that opinion.
Spiritwalker
01-20-2010, 10:11 AM
Since abortion is legal, it's not murder by the standards in place by our laws. Just like the argument that some on this forum have used saying that since the death penalty is legal, it isn't murder.
The death penalty IS murder... I just have no problem with taking the life of someone that shown that they have no problems with being such a destructive member of society....
(there you go Nate.. I just gave you an underhanded pitch.. knowck it out of the park..:) )
DonnaMaria
01-20-2010, 03:34 PM
So how old does a baby have to be for it to be murder?
A person's a person no matter how small!:)
~Dr. Seuss
Spiritwalker
01-20-2010, 03:35 PM
A person's a person no matter how small!:)
~Dr. Seuss
Point.
Miss Foxy
01-20-2010, 03:36 PM
A person's a person no matter how small!:)
~Dr. SeussVery true sister!! We shall all protect our babies no matter how small..
Miss Foxy
01-20-2010, 03:39 PM
If I were told to abort my baby to save my own life I would NOT!! I can tell you as a mother of 2 that I mean that sincerely. I could not fathom the thought of killing my own baby..:sad:
mscomc
01-20-2010, 04:12 PM
If you want a quantifiable standard of measurement for when life begins, then the closest thing we have right now is DNA. A sperm and an egg are haploid cells, which means that they each only contain half of the genetic information necessary to make a human being. As soon as the sperm fertilizes the egg, those two half strands make a whole DNA strand. Thus, creating a completely new and unique human being with its own DNA that is separate from the mother.
The important factor to consider here is that the DNA strand created contains 100% of the information necessary for that single cell to form into a full grown adult. No new genetic information will be added to that person's DNA in their lifetime. Information will be lost, but not added.
So, using our current knowledge of genetics, it can be said to be a scientific fact that life begins at the moment of conception. Every other standard of "humanness" is subjective.
Sorry friend, not true.....
mscomc
01-20-2010, 04:20 PM
If you want a quantifiable standard of measurement for when life begins, then the closest thing we have right now is DNA. A sperm and an egg are haploid cells, which means that they each only contain half of the genetic information necessary to make a human being. As soon as the sperm fertilizes the egg, those two half strands make a whole DNA strand. Thus, creating a completely new and unique human being with its own DNA that is separate from the mother.
The important factor to consider here is that the DNA strand created contains 100% of the information necessary for that single cell to form into a full grown adult. No new genetic information will be added to that person's DNA in their lifetime. Information will be lost, but not added.
So, using our current knowledge of genetics, it can be said to be a scientific fact that life begins at the moment of conception. Every other standard of "humanness" is subjective.
I think this is one place of divergence between pro-life groups and pro-choice. I fully agree with you that all the information that is 'necessary' is there, but it cant survive on its own yet. In fact if you study the molecular bio of zygote (even a couple weeks after)....the morphology, metabolic pathways activated and overall function isnt than much different that a yeast cell. Of course once higher order structure form (connective tissues, brain matter, spinal tissue, limbs etc etc) then its clearly distinct.
That has always had me on the teter-totter. When the fetus has what is necessary. I have heard some make the somewhat analagous comparison of: a college student may have all the coursework and grades to neccessary to be a lawyer, but he isnt one until he graduates. similarily, the fetus has all the info neccessary, but it isnt a person until it can survive on its own (6-7 months'ish)
NateR
01-20-2010, 05:12 PM
Sorry friend, not true.....
Explain.
Tyburn
01-20-2010, 07:19 PM
Explain.
He's probably gonna get smart and talk about an infection by a Virus...although he should be aware they work with RNA not actual DNA :ninja:
NateR
01-20-2010, 07:33 PM
He's probably gonna get smart and talk about an infection by a Virus...although he should be aware they work with RNA not actual DNA :ninja:
I guess I should have clarified that there is no new genetic information, barring mutations from viral infections. The point being that everything necessary to make the one-celled embryo into a human being is present immediately after fertilization. Genetically, the one-celled embryo is not 10% human, or 50% human or even 90% human, it is 100% human.
That's not religion or politics, that is science.
mscomc
01-20-2010, 08:01 PM
He's probably gonna get smart and talk about an infection by a Virus...although he should be aware they work with RNA not actual DNA :ninja:
Well, actually I wasn't going to mention viral infection. Secondly, in regards to the bolded region above...are you serious? not actual DNA? You saying there is no DNA involved? Wow, someone needs to review their BASIC biology book, and review a little enzyme called Reverse Transcriptase:Whistle: And if you want to debate that, try me :wink:
I was actually just going to PM nate on how human on our own can alter our own DNA sequence through lengthening and adding a length mutation. Nate, you may recall that we talked about this a little some time ago, but I dont think i explained it well....it's pretty hard to explain just using words and not diagrams and figures along with it. Let me get the info together, and I'll get back to you.
Tyburn
01-20-2010, 08:43 PM
Well, actually I wasn't going to mention viral infection. Secondly, in regards to the bolded region above...are you serious? not actual DNA? You saying there is no DNA involved? Wow, someone needs to review their BASIC biology book, and review a little enzyme called Reverse Transcriptase:Whistle: And if you want to debate that, try me :wink:
I was actually just going to PM nate on how human on our own can alter our own DNA sequence through lengthening and adding a length mutation. Nate, you may recall that we talked about this a little some time ago, but I dont think i explained it well....it's pretty hard to explain just using words and not diagrams and figures along with it. Let me get the info together, and I'll get back to you.
Yes...thank you I did manage to get a C in biology at A LEVEL :laugh: Biochemistry was never one of my strong points...I think you find that Virus are still RNA rather then DNA...though I couldnt now tell you what the difference is or was :laugh:
Mutations...that doesnt change the point that Nathan is making.
He is saying, Genetically speaking, the Human is whole the second of fertilization...that is absolutely true.
mscomc
01-20-2010, 08:59 PM
Yes...thank you I did manage to get a C in biology at A LEVEL :laugh: Biochemistry was never one of my strong points...I think you find that Virus are still RNA rather then DNA...though I couldnt now tell you what the difference is or was :laugh:
Mutations...that doesnt change the point that Nathan is making.
He is saying, Genetically speaking, the Human is whole the second of fertilization...that is absolutely true.
1) 'Virus are still RNA rather then DNA"----- Actually, No I wouldnt agrew with that. A "C" in A LEVEL, I am not trying to be mean or condescending (really I am not), but are you bragging or something?
2) I am not talking about POINT mutations, or substitutions or deletions. I'm talking about actually EXPANDING....NEW.....genetic info into our genomes by our bodies own mechanism.
3) I do agree with Nate that "everything necessary to make the one-celled embryo into a human being is present immediately after fertilization". I am just offering him some extra info, and since he said explain, and I know he values knowledge, I was going to offer him some.
----- Back to the topic, In his sentence himself, Nate said, "make the one-celled embryo into a human being "....sounds like to me he agrees the embryo is not a human yet (I know I am playing semantics with what he really means)....But, I think this is a crucial point here. When is the fetus a human?
NateR
01-20-2010, 10:38 PM
----- Back to the topic, In his sentence himself, Nate said, "make the one-celled embryo into a human being "....sounds like to me he agrees the embryo is not a human yet (I know I am playing semantics with what he really means)....But, I think this is a crucial point here. When is the fetus a human?
No it is a human, I was using the term "one-celled embryo" to specify the stage of development. Since people are always asking me to clarify what I mean in this thread, I thought the distinction was necessary. I believe the one-celled embryo to the be earliest stage of humanity, because going by genetics alone it's just as human as we are.
mscomc
01-20-2010, 11:25 PM
No it is a human, I was using the term "one-celled embryo" to specify the stage of development. Since people are always asking me to clarify what I mean in this thread, I thought the distinction was necessary. I believe the one-celled embryo to the be earliest stage of humanity, because going by genetics alone it's just as human as we are.
hmmm, maybe its just the way ive been trained, i wouldn't completely agree with that....but I know what your saying. Ok, ill go with that. Genetically ok i agree, physiologically, no way, thats just me though.
Since abortion is legal, it's not murder by the standards in place by our laws. Just like the argument that some on this forum have used saying that since the death penalty is legal, it isn't murder.
Are you pro-life?
Buzzard
01-21-2010, 03:18 AM
Are you pro-life?
Yes. Being pro-life, I am also against the death penalty. I also think hunting for sport sucks.
Neezar
01-21-2010, 03:37 AM
2) I am not talking about POINT mutations, or substitutions or deletions. I'm talking about actually EXPANDING....NEW.....genetic info into our genomes by our bodies own mechanism.
Where does it get this NEW info? Or are you talking about rearranging old info to make it have a different outcome?
Neezar
01-21-2010, 03:39 AM
Thats an interesting point you bring up (i assume you mean the physiological difference). I remember reading an article/survey in an undergrad psych elective I took that was talking about women who were considering abortion due to threat of their own life. They said if they were ever in that situation, they said they would NOT do it if they thought the fetus/baby could feel pain...some justified that as "if it can't sense anything yet, then it isnt a person yet".
Along the same time the American Medical Assocation began to study this. In their 2005 paper (http://jama.ama-assn.org/cgi/content/short/294/8/947) they showed that since thalamocortical fibers dont form until 23-30 weeks, the fetus cant functionally process pain. As far as I know, this has not been refuted, and subsequent studies have only confirmed these findings.
There was that video some of you may know of, "the silent scream" that showed footage of a 12 week old embryo moving while the procedure was being done on it. But this was refuted (even by some pro-life docs if i recall) because withdrawal reflexes to invasive procedures do not prove the existence of fetal pain, because those same responses can be elicited by nonpainful stimuli and occur without conscious cortical processing.
------ How does that change the debate? Im not sure, but just some info I thought you may like to know.
Well these women should be reminded that science consistantly proves itself wrong.
:laugh:
mscomc
01-21-2010, 03:47 AM
Where does it get this NEW info? Or are you talking about rearranging old info to make it have a different outcome?
Well that is part of it. If you are thinking of acquiring new info in the sense of "injecting" something into the cell.....thats not how genetics/molecular bio works. I said expand the info. When you expand the genome, this creates new Open reading frames, new promoter sequences, new activators...which means new proteins, new homologs for exisitng genes...etc etc etc.
But that also means that you can disrupt current genes for the sake of expanding the genome (ie: cancer).
have you done any molecular biology or genomics/systems biology?
Neezar
01-21-2010, 03:56 AM
Well that is part of it. If you are thinking of acquiring new info in the sense of "injecting" something into the cell.....thats not how genetics/molecular bio works. I said expand the info. When you expand the genome, this creates new Open reading frames, new promoter sequences, new activators...which means new proteins, new homologs for exisitng genes...etc etc etc.
But that also means that you can disrupt current genes for the sake of expanding the genome (ie: cancer).
have you done any molecular biology or genomics/systems biology?
No, no special study. But I was taught that the basic stuff is already there. And everything is just all about how it is put together. To me, that isn't NEW information just a reworking of what you have. Any changes you have is a rearrangement of what you have or a loss of info, never gaining NEW info.
mscomc
01-21-2010, 04:15 AM
No, no special study. But I was taught that the basic stuff is already there. And everything is just all about how it is put together. To me, that isn't NEW information just a reworking of what you have. Any changes you have is a rearrangement of what you have or a loss of info, never gaining NEW info.
I am sorry, but i fundamentally disagree. That's why I asked you if you had taken any advance cell bio / biochem.... heres a basic 'schematic'...assume A, C, G, T as our nucleotides...we wont use modified ones, they muddy the waters.
Suppose I had this gene...
5 ' AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA '3
Ok, so this gets transcribed into mRNA, then eventually translated into premature protein. Some genes (like the retro-transposons) encode their own reverse transcriptase and turn the mRNA back into its DNA and intergrate it BACK INTO the genome....NOW I HAVE TWO COPIES (see below)
AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA - AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA
I just completely changed the genome. If we started out with 50 bases, now we have a 100....how is that NOT new????
I put that dash in their to symbolize the following.....where does it re-insert the copy? is it random? it programmed? can it activate an oncogene? (cancer gene)
OR to really complicate things, what if during that reverse transcribing, the transciptase enzyme makes an error in putting the base pairs and instead the original AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA it infact creates a homolog of AAAAGGGTTTCCCTTTtGGAAATTTGGGAAATTTGGGAA ???
This piece of DNA is COMPLETELY unique!!!! it wasnt part of the orignal genome that you had as a zygote. How is that not new? how is that just re-arrangement. To rearrange means you moved something, but the component remains the same. If i had 3 boxes on a shelf, and changed their order, i agree, its only been rearragned......... but if i added 10 more boxes the shelf, you are telling me that isn't new????
Well if you still dont believe that, then i guess we have to agree to disagree :)
Neezar
01-21-2010, 01:29 PM
I am sorry, but i fundamentally disagree. That's why I asked you if you had taken any advance cell bio / biochem.... heres a basic 'schematic'...assume A, C, G, T as our nucleotides...we wont use modified ones, they muddy the waters.
Suppose I had this gene...
5 ' AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA '3
Ok, so this gets transcribed into mRNA, then eventually translated into premature protein. Some genes (like the retro-transposons) encode their own reverse transcriptase and turn the mRNA back into its DNA and intergrate it BACK INTO the genome....NOW I HAVE TWO COPIES (see below)
AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA - AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA
I just completely changed the genome. If we started out with 50 bases, now we have a 100....how is that NOT new????
I put that dash in their to symbolize the following.....where does it re-insert the copy? is it random? it programmed? can it activate an oncogene? (cancer gene)
OR to really complicate things, what if during that reverse transcribing, the transciptase enzyme makes an error in putting the base pairs and instead the original AAAAGGGTTTCCCTTTGGGAAATTTGGGAAATTTGGGAA it infact creates a homolog of AAAAGGGTTTCCCTTTtGGAAATTTGGGAAATTTGGGAA ???
This piece of DNA is COMPLETELY unique!!!! it wasnt part of the orignal genome that you had as a zygote. How is that not new? how is that just re-arrangement. To rearrange means you moved something, but the component remains the same. If i had 3 boxes on a shelf, and changed their order, i agree, its only been rearragned......... but if i added 10 more boxes the shelf, you are telling me that isn't new????
Well if you still dont believe that, then i guess we have to agree to disagree :)
Allow me to reword....
I was saying that copying the bases and putting them in a new order to create something is understood. That has been happening since the beginning of time (whenever that may be, lol). But everything is still made out of the same old bases, no new stuff. I am talking about, you are never going to find an 'q' in there when there wasn't a 'q' in the the base to start with. That would be NEW info/stuff you call bases and not just a new substance created with all your same old stuff/bases. So I still can't disbute what I was taught. Everything is created by rearranging (and copying) what we have started with (info/bases) or by losing info, never NEW info/bases introduced.
mscomc
01-21-2010, 02:28 PM
Allow me to reword....
I was saying that copying the bases and putting them in a new order to create something is understood. That has been happening since the beginning of time (whenever that may be, lol). But everything is still made out of the same old bases, no new stuff. I am talking about, you are never going to find an 'q' in there when there wasn't a 'q' in the the base to start with. That would be NEW info/stuff you call bases and not just a new substance created with all your same old stuff/bases. So I still can't disbute what I was taught. Everything is created by rearranging (and copying) what we have started with (info/bases) or by losing info, never NEW info/bases introduced.
hmmm, well if you are saying that a brand new, from scratch base entered into the genome, ok, i agree with that. Well, not really, but for the sake our little harmony..ok i agree. I am just saying, the DNA code is one thing...each time you only "re-arrange" something, you could have very well created exponentially new ways to make new compounds: enzymes, channels, porins, peptide hormones etc etc that we didnt have to begin with.
well, of to work I go.....PEACE
Tyburn
01-21-2010, 04:50 PM
Allow me to reword....
I was saying that copying the bases and putting them in a new order to create something is understood. That has been happening since the beginning of time (whenever that may be, lol). But everything is still made out of the same old bases, no new stuff. I am talking about, you are never going to find an 'q' in there when there wasn't a 'q' in the the base to start with. That would be NEW info/stuff you call bases and not just a new substance created with all your same old stuff/bases. So I still can't disbute what I was taught. Everything is created by rearranging (and copying) what we have started with (info/bases) or by losing info, never NEW info/bases introduced.
GOOD POINT.
Different Codes creating different things...but only a finite number of symbols to create your code.
so...without new symbols...then essentially, there is no new genetic information...its just that you can rearrange the symbols to change something...that change might be new I grant you...but we're saying its effectively a serface change on the Genetic Level
Unless whats-his-chops-biologist-man knows how you can make new symbols :huh:
Bonnie
01-21-2010, 04:59 PM
"what's his chops" :laugh: Sorry, MS, :ashamed: Dave just struck my funny bone.
I have a question. Hope it's not too dumb to all you smarties. If our DNA changes, how are they able to get criminals using DNA?
NateR
01-21-2010, 05:12 PM
"what's his chops" :laugh: Sorry, MS, :ashamed: Dave just struck my funny bone.
I have a question. Hope it's not too dumb to all you smarties. If our DNA changes, how are they able to get criminals using DNA?
I don't think DNA identification is ever 100% positive. Usually 97-98% is the best we can hope for. That's why other evidence would be necessary to place the suspect at the crime scene.
Tyburn
01-21-2010, 06:07 PM
"what's his chops" :laugh: Sorry, MS, :ashamed: Dave just struck my funny bone.
:laugh: pardon...its an expression I use when I dont have the actual name of the person to hand...or cant remember their screen name :laugh:
:ashamed:
mscomc
01-21-2010, 07:21 PM
GOOD POINT.
Different Codes creating different things...but only a finite number of symbols to create your code.
so...without new symbols...then essentially, there is no new genetic information...its just that you can rearrange the symbols to change something...that change might be new I grant you...but we're saying its effectively a serface change on the Genetic Level
Unless whats-his-chops-biologist-man knows how you can make new symbols :huh:
Well, I didnt want to get into this to much, as it reallllllllly complicates things. But yes, the body can create new base pairs OTHER than A, C, G, T as we know it. We still dont know if this is programmed (like cell death)....or if its just random. For example, In DNA, there is 5-methylcytidine (or m5C), Hypoxanthine, which comes from a purine base, Xanthine which is also a purine. We know that these are definitetly made through mutagens....but what the mutagen is, is the nobel prize question :laugh:
These modified base pairs can really disrupt gene function by incorporating themselves into a DNA chain. BUT!!!!! sometimes these disruptive incorporations have worked out in helping us fight certain diseases, as i have mentioned in threads in the past.
mscomc
01-21-2010, 07:30 PM
"what's his chops" :laugh: Sorry, MS, :ashamed: Dave just struck my funny bone.
I have a question. Hope it's not too dumb to all you smarties. If our DNA changes, how are they able to get criminals using DNA?
Not dumb at all, its a great question.:)
The DNA does not work as follows. I take the suspect criminal DNA, sequence it, and then compare it to the sequence of whatever we found at the crime scene. This would take forever, its incredibly expensive, a huge pain in the rear, and its sensitive to contamination.
What we do is the following. I take the suspect DNA, and treat it with a chemical that will cut your whole DNA into roughly 100 (assume 100) visible (through UV light, on a sugar gel) pieces. I then take the crime scene DNA, and treat it with the EXACT same chemical and cut it into a hundred pieces. If they DNA is the same, then the 'profile' of the cuts should be the same.... with this method, you can usually get accuracy of: 1/44,000 chance that this persons DNA doesnt match. So it is really good.
On a side note, Im afraid the days of DNA evidence will be coming to an end. With technology advancing, it is now possible to comit DNA evidence fraud. In other words, I can commit a murder, but 'plant' your DNA at the crime scene, and chances are, they will never find out the fraud. Want to hear the really scary part? It so easy to do, that even a 2nd year undergrad in biochem/biology can do it.....
Tyburn
01-21-2010, 10:05 PM
Not dumb at all, its a great question.:)
The DNA does not work as follows. I take the suspect criminal DNA, sequence it, and then compare it to the sequence of whatever we found at the crime scene. This would take forever, its incredibly expensive, a huge pain in the rear, and its sensitive to contamination.
What we do is the following. I take the suspect DNA, and treat it with a chemical that will cut your whole DNA into roughly 100 (assume 100) visible (through UV light, on a sugar gel) pieces. I then take the crime scene DNA, and treat it with the EXACT same chemical and cut it into a hundred pieces. If they DNA is the same, then the 'profile' of the cuts should be the same.... with this method, you can usually get accuracy of: 1/44,000 chance that this persons DNA doesnt match. So it is really good.
On a side note, Im afraid the days of DNA evidence will be coming to an end. With technology advancing, it is now possible to comit DNA evidence fraud. In other words, I can commit a murder, but 'plant' your DNA at the crime scene, and chances are, they will never find out the fraud. Want to hear the really scary part? It so easy to do, that even a 2nd year undergrad in biochem/biology can do it.....
"The Intelligence of the Intelligent I shall Frustrate"
Bonnie
01-21-2010, 11:30 PM
Not dumb at all, its a great question.:)
The DNA does not work as follows. I take the suspect criminal DNA, sequence it, and then compare it to the sequence of whatever we found at the crime scene. This would take forever, its incredibly expensive, a huge pain in the rear, and its sensitive to contamination.
What we do is the following. I take the suspect DNA, and treat it with a chemical that will cut your whole DNA into roughly 100 (assume 100) visible (through UV light, on a sugar gel) pieces. I then take the crime scene DNA, and treat it with the EXACT same chemical and cut it into a hundred pieces. If they DNA is the same, then the 'profile' of the cuts should be the same.... with this method, you can usually get accuracy of: 1/44,000 chance that this persons DNA doesnt match. So it is really good.
On a side note, Im afraid the days of DNA evidence will be coming to an end. With technology advancing, it is now possible to comit DNA evidence fraud. In other words, I can commit a murder, but 'plant' your DNA at the crime scene, and chances are, they will never find out the fraud. Want to hear the really scary part? It so easy to do, that even a 2nd year undergrad in biochem/biology can do it.....
That is scary! :scared0011:
So, what are they (I don't know if I should call them scientists or what, Malcolm?) going to advance to next regarding DNA evidence in solving crimes and catching the bad guys?
Yes. Being pro-life, I am also against the death penalty. I also think hunting for sport sucks.
Are you a Christian? I think all Christians are at a higher level of laws. Possibly the Ten Comandments?
The death penalty is just fine with me.
Genesis 9:6
Whoever sheds the blood of man,
by man shall his blood be shed;
for in the image of God
has God made man.
Romans 13
Submission to the Authorities
1Everyone must submit himself to the governing authorities, for there is no authority except that which God has established. The authorities that exist have been established by God. 2Consequently, he who rebels against the authority is rebelling against what God has instituted, and those who do so will bring judgment on themselves. 3For rulers hold no terror for those who do right, but for those who do wrong. Do you want to be free from fear of the one in authority? Then do what is right and he will commend you. 4For he is God's servant to do you good. But if you do wrong, be afraid, for he does not bear the sword for nothing. He is God's servant, an agent of wrath to bring punishment on the wrongdoer.
Acts 5
Ananias and Sapphira
1Now a man named Ananias, together with his wife Sapphira, also sold a piece of property. 2With his wife's full knowledge he kept back part of the money for himself, but brought the rest and put it at the apostles' feet.
3Then Peter said, "Ananias, how is it that Satan has so filled your heart that you have lied to the Holy Spirit and have kept for yourself some of the money you received for the land? 4Didn't it belong to you before it was sold? And after it was sold, wasn't the money at your disposal? What made you think of doing such a thing? You have not lied to men but to God."
5When Ananias heard this, he fell down and died. And great fear seized all who heard what had happened. 6Then the young men came forward, wrapped up his body, and carried him out and buried him.
7About three hours later his wife came in, not knowing what had happened. 8Peter asked her, "Tell me, is this the price you and Ananias got for the land?"
"Yes," she said, "that is the price."
9Peter said to her, "How could you agree to test the Spirit of the Lord? Look! The feet of the men who buried your husband are at the door, and they will carry you out also."
10At that moment she fell down at his feet and died. Then the young men came in and, finding her dead, carried her out and buried her beside her husband. 11Great fear seized the whole church and all who heard about these events.
As you can see the death penalty has been around for a long time.
mscomc
01-22-2010, 02:17 AM
That is scary! :scared0011:
So, what are they (I don't know if I should call them scientists or what, Malcolm?) going to advance to next regarding DNA evidence in solving crimes and catching the bad guys?
I honestly have no idea. Current technology cant effectively combat this problem. I just think, and i really mean this, cops and lawyers are going to have to go back out and WORK. I dont mean this with all cops and lawyers, but some have seriously enjoyed the 'free' ride to much.
"oooo, i got DNA? case closed"--------> days are coming to an end.
Bonnie
01-22-2010, 02:20 AM
To each his own. I don't have a problem with the death penalty. Whether they get life (true life) with no parole and eventually die in prison or finally (after all their appeals) get put to death by the state...either way they die. So really what's the problem. They chose not to be a law-abiding citizen while in society; they made their bed.... :wink:
I do believe there are some who are truly innocent in prison and who have been put to death.
If I was facing life in prison whether I was truly guilty or innocent (after all my appeals of course :wink:), I would rather them kill me than spend my life in a 6 x 6 cell always fearing rape or whatever at the hands of my fellow prisoners.
If I had my choice they would go the same way their victims did, but we've got rules and laws we have to follow... :wink:
Buzzard
01-23-2010, 02:33 AM
Are you a Christian? I think all Christians are at a higher level of laws. Possibly the Ten Comandments?
The death penalty is just fine with me.
Genesis 9:6
Whoever sheds the blood of man,
by man shall his blood be shed;
for in the image of God
has God made man.
Romans 13
Submission to the Authorities
1Everyone must submit himself to the governing authorities, for there is no authority except that which God has established. The authorities that exist have been established by God. 2Consequently, he who rebels against the authority is rebelling against what God has instituted, and those who do so will bring judgment on themselves. 3For rulers hold no terror for those who do right, but for those who do wrong. Do you want to be free from fear of the one in authority? Then do what is right and he will commend you. 4For he is God's servant to do you good. But if you do wrong, be afraid, for he does not bear the sword for nothing. He is God's servant, an agent of wrath to bring punishment on the wrongdoer.
Acts 5
Ananias and Sapphira
1Now a man named Ananias, together with his wife Sapphira, also sold a piece of property. 2With his wife's full knowledge he kept back part of the money for himself, but brought the rest and put it at the apostles' feet.
3Then Peter said, "Ananias, how is it that Satan has so filled your heart that you have lied to the Holy Spirit and have kept for yourself some of the money you received for the land? 4Didn't it belong to you before it was sold? And after it was sold, wasn't the money at your disposal? What made you think of doing such a thing? You have not lied to men but to God."
5When Ananias heard this, he fell down and died. And great fear seized all who heard what had happened. 6Then the young men came forward, wrapped up his body, and carried him out and buried him.
7About three hours later his wife came in, not knowing what had happened. 8Peter asked her, "Tell me, is this the price you and Ananias got for the land?"
"Yes," she said, "that is the price."
9Peter said to her, "How could you agree to test the Spirit of the Lord? Look! The feet of the men who buried your husband are at the door, and they will carry you out also."
10At that moment she fell down at his feet and died. Then the young men came in and, finding her dead, carried her out and buried her beside her husband. 11Great fear seized the whole church and all who heard about these events.
As you can see the death penalty has been around for a long time.
No, I am Agnostic. What do you mean by "all Christians are at a higher level of laws?
There are many things and concepts that have been around for a long time, but just because they have been around for a long time, does not make them good or right.
While quoting scripture to support the death penalty may be good for you, to me it is just the written word of man and doesn't hold any higher status than that. Please don't take offense that I don't see scripture as being the true word of God.
Are you ok that innocent people can be put to death in error with the death penalty?
Out of curiosity, do you hunt for sport? If you do, do you think that is something that Jesus would approve of? Taking the life of something just to entertain yourself does not seem very sporting or honorable to me. What are your thoughts on that?
No, I am Agnostic. What do you mean by "all Christians are at a higher level of laws? I believe that a Christian wiil try to follow Gods laws.
There are many things and concepts that have been around for a long time, but just because they have been around for a long time, does not make them good or right. What are you refering to?
While quoting scripture to support the death penalty may be good for you, to me it is just the written word of man and doesn't hold any higher status than that. Please don't take offense that I don't see scripture as being the true word of God. What do you believe in? What happens when you die? Does everyone go to heaven? Is there a heaven?
Are you ok that innocent people can be put to death in error with the death penalty? Innocent people die everyday. People die everyday. Jesus was put to death and he was innocent.
Out of curiosity, do you hunt for sport? If you do, do you think that is something that Jesus would approve of? Taking the life of something just to entertain yourself does not seem very sporting or honorable to me. What are your thoughts on that? Yes I do, there is not much meat on a coyote though. So you are for no hunting? Where would we be if we could not regulate the population of deer here in Illinois?
NateR
01-23-2010, 03:32 AM
Are you ok that innocent people can be put to death in error with the death penalty?
This is why no one should be sentenced to death unless there are 2 or more eyewitnesses to the crime. This is how it was set up in the Bible:
Deuteronomy 19:15
"One witness shall not rise against a man concerning any iniquity or any sin that he commits; by the mouth of two or three witnesses the matter shall be established."
Out of curiosity, do you hunt for sport? If you do, do you think that is something that Jesus would approve of? Taking the life of something just to entertain yourself does not seem very sporting or honorable to me. What are your thoughts on that?
Do you eat meat? Do you really believe that the meat you buy in the grocery store was killed in a more humane manner?
Spiritwalker
01-23-2010, 03:46 AM
Do you eat meat? Do you really believe that the meat you buy in the grocery store was killed in a more humane manner?
Not really.
If I had to do it. I would, but I would prolly be a vegetarian if it was up to me to kill the meat.. maybe.. I have never been in that situation.
does anyone on this forum hunt just for sport?
NateR
01-23-2010, 04:17 AM
Most of the meat from these cows ended up in public school lunchrooms:
http://www.youtube.com/watch?v=CrxvxewC-gA
AP story about this video (ignore the commercial at the beginning):
http://www.youtube.com/watch?v=atoUonz-Rzo
Yeah, much more humane than hunting. :rolleyes:
does anyone on this forum hunt just for sport?
Certain things i do . Yotes are one of them , thier pelts are not selling worth anything and i dont eat dogs. I just shoot em to shoot em . I mean there are reasons behind it . The fewer coyotes you have , the more small game you have like rabbits and quail . Which i do eat.
And i shoot the heck out of sparrows and black birds because they crap all over the cars and destroy my moms garden and build nests in the garage .
MattHughesRocks
01-23-2010, 05:55 AM
Don't forget the clubbing of those nasty lil bastards :wink:
Certain things i do . Yotes are one of them , thier pelts are not selling worth anything and i dont eat dogs. I just shoot em to shoot em . I mean there are reasons behind it . The fewer coyotes you have , the more small game you have like rabbits and quail . Which i do eat.
And i shoot the heck out of sparrows and black birds because they crap all over the cars and destroy my moms garden and build nests in the garage .
Buzzard
01-23-2010, 06:13 AM
Yes I do, there is not much meat on a coyote though. So you are for no hunting? Where would we be if we could not regulate the population of deer here in Illinois?
I'm not against hunting for food. Hunting for the sake of sport to satisfy a need to kill a living creature for fun I am against. Again, hunting deer for food is certainly different than hunting something for sport. Feeding a family is different than feeding an ego or the desire to kill for pleasure.
There are many things and concepts that have been around for a long time, but just because they have been around for a long time, does not make them good or right. What are you refering to?
I'm referring to your statement,As you can see the death penalty has been around for a long time. Since the death penalty has been around for a long time does not mean that it is a good thing. Acts of violence such as rape and murder have also been around for a long time, and I don't see many people saying those are good things.
What do you believe in? What happens when you die? Does everyone go to heaven? Is there a heaven?
I believe in many things, just not the God as is portrayed by man. When I die, I die. I don't think anyone goes to heaven as I don't believe in the concept of heaven. Perhaps heaven is in another dimension or not, but I honestly don't believe in it. I could be wrong and I'm not saying there isn't a heaven, as I really don't know if there is or not. My gut belief is that there isn't.
Are you ok that innocent people can be put to death in error with the death penalty? Innocent people die everyday. People die everyday.
Yes, innocent people do die everyday, but they shouldn't as a matter of governmental policy. Since you are against abortion, I would think that you would also be against putting innocent folks who have already been born to death. What's the difference? In each case an innocent life has been snuffed.
This is why no one should be sentenced to death unless there are 2 or more eyewitnesses to the crime. This is how it was set up in the Bible:
Deuteronomy 19:15
"One witness shall not rise against a man concerning any iniquity or any sin that he commits; by the mouth of two or three witnesses the matter shall be established."
I'd rather proof and evidence of guilt be used rather than just 2 folks eyewitness testimony, which as we know is not always factual or true in some instances.
Do you eat meat? Do you really believe that the meat you buy in the grocery store was killed in a more humane manner?
What does me eating meat have to do with hunting and taking the life of a living creature for sport and entertainment value?
NateR
01-23-2010, 06:37 AM
Since you are against abortion, I would think that you would also be against putting innocent folks who have already been born to death. What's the difference? In each case an innocent life has been snuffed.
I can't speak for Mark, but I'm pretty sure that he's referring to people who are found guilty of a violent crime in a court of law, not innocent people, recieving the death penalty. NOBODY wants to see an innocent person wrongfully put to death.
I'd rather proof and evidence of guilt be used rather than just 2 folks eyewitness testimony, which as we know is not always factual or true in some instances.
Um, eyewitness testimony is some of the best evidence you can have against someone in a court of law. :rolleyes:
Buzzard
01-23-2010, 06:57 AM
Um, eyewitness testimony is some of the best evidence you can have against someone in a court of law. :rolleyes:
If you are serious about this, I suggest you read up more on it. Hopefully you were joking and that is what the rolleyes emoticon was displaying.
Tyburn
01-23-2010, 11:23 AM
Certain things i do . Yotes are one of them , thier pelts are not selling worth anything and i dont eat dogs. I just shoot em to shoot em . I mean there are reasons behind it . The fewer coyotes you have , the more small game you have like rabbits and quail . Which i do eat.
And i shoot the heck out of sparrows and black birds because they crap all over the cars and destroy my moms garden and build nests in the garage .
:unsure-1:
I think its alright to hunt for food. GOD says in Genesis that the animals are to be given to us as food. GOD also accepts Animal Sacrifices...He likes the scent of burnt meat :blink: He finds it "pleasing" :laugh:
I think that in the U.S sometimes you have to hunt in order to keep the ecosystem in ballance. Animals kill animals, all you effectively do is join the ecosystem as a preditor...if you have two many of one animal, it can actually distory other systems of life...its like a cull, or its like pruning a plant, you must keep it in check. I was satisfied this was the case when the hunters on this forum told me that you could only hunt certain things at certain times, and only a specific amount of animals may be hunted...that to me seems well thought out and wholly justified.
What I think you should be careful about is just killing for fun. Thats not nice, its not looking after the animals GOD has put into your care. Mac I DONT think you should kill Sparrows...because they are used in Scripture...actually NAMED in scripture as an animal the GOD cares for and is aware of...I personally would also suggest keeping away from any type of dove, because it just doesnt seem right to shoot and kill something that GOD has used as an illustration of His Spirit.
Bonnie
01-23-2010, 01:53 PM
Um, eyewitness testimony is some of the best evidence you can have against someone in a court of law. :rolleyes:
You are kidding about this, aren't you, Nate? :unsure-1:
Because I've read where it is less reliable and I can testify first hand on this myself.
The day we were moving to where we live now we were waiting for the moving guys to get to our house. So I'm standing at the kitchen window and I notice this white pick-up drop this young man off across the street in front of my neighbor's house. I thought this was unusual so I watched him. He walked down the street to a house that had the garage door up and open. He went in and came out with a bag of golf clubs and started walking back down the street towards my house. The really brazen thing is the owner was in his front yard when the guy did this. The owner (an older guy) started after him. I called to my husband and told him to call the police and I went outside to try to stop the guy. My husband soon followed. So when the guy sees us he stops and I tell him we've already called the police and David starts towards the guy, but stops when the guy acts like he's got a weapon. Then the guy motions with his arm (like when you're telling someone to come and get you) so I look up a block and there is that white pick-up truck. The guy in the truck was obviously waiting for him but when he saw what was going on he hightailed it out of there leaving the other guy high and dry. Well the guy drops the clubs and starts walking towards the street leading out of our addition. Unfortunately, David hadn't called the cops already 'cause when I went outside he was worried for me so he called them now. So I run and jump in my car and follow the guy but lose him when he goes between some houses.
This is where the eyewitness part comes in. :laugh: So this young officer arrives and the three of us tell him what happened. So the officer asks us what he was wearing. David and I both answer at the same time. David says "white" t-shirt and I say "black" t-shirt. :rolleyes: I look at David and then I look at the officer and he has this big grin on his face and I know immediately what he's thinking, "how 'unreliable' eyewitness accounts are". :laugh: I mean we had just seen this thief moments ago and we couldn't agree on what he was wearing. We were literally just feet away from the guy. :wacko: So I learned first hand how in the heat of the moment our memories aren't always as reliable as we might think they are and how innocent people might and do get charged with something they didn't do. :wink:
On a side note another funny part of the story. The moving guys showed up right after the cop came. So the cop asks me if I'd ride with him to show him where the guy went and I said sure. So he goes and opens the "back" door of the police car (for some reason I thought I'd get to ride in front) and I get in behind the cage. I look over at the moving guys and they're all looking at us as the cop is putting me in his car. I knew what they were thinking. :laugh: When I got back one of them said, "Yeah, we thought he was taking you away to jail!" :laugh:
I'm referring to your statement, Since the death penalty has been around for a long time does not mean that it is a good thing. Acts of violence such as rape and murder have also been around for a long time, and I don't see many people saying those are good things.
So you are telling me that you would never kill anyone ever? If I woke up in the middle of the night to a noise, I would get my gun (Its right by my bed) and look and see what is going on. If there is a person in my house I would shoot them. Would you do the same?
So you are telling me that you would never kill anyone ever? If I woke up in the middle of the night to a noise, I would get my gun (Its right by my bed) and look and see what is going on. If there is a person in my house I would shoot them. Would you do the same?
I agree . I have a pistol that hangs on my bedpost as well as something that will shoot through the walls if needed. When it comes to my family i will protect them until every ounce of life is pulled from my body with whatever tools or means i have .
Now dont go taking this as if something stirs im shooting . Ive taken tail lights out of a truck or two that came slinking up the driveway before , but that was only when they wouldnt stop when i hollered and decided to leave. I wanted to let them know that this is not the house to be messing with at 3 oclock in the morning and that someone is armed and awake. I wasnt shooting to kill , i aimed right at the tailights and removed them from the truck . But i am very protective , especially when it comes to my home and my family. There is no good reason for them being here especially when they see me and peel out to get away . Many folks have been met at my doorway late at night and met with me and a firearm of some sort . And if they are actually needing help then i help . But im not taking a chance .
So to answer the question with less rambling . Yes , i would take someones life without second thought if it meant the life of one of my family members. If someone was threatening a family member of mine with death or harm there would be no questions . And honestly , it doesnt stop there. I feel the same way about children , or any helpless person . I generally have a rifle in the truck with me , i just figure if something bad happens i am a first responder. If you have the means i think you should be a protector of the meek . say for instance you are driving past a school and notice a man with a rifle walking across the playground . I would have no hesitations . I would get him in the crosshairs first , and then tell him to drop the weapon , he would be informed that this is his only warning , the next shot would probably be through the knee , or both of them to disable him where he stands . If kids were present it would be through the head to ensure noone else would be injured.
I feel its our duty to protect those who cannot protect themselves.
I want to know something since we are ont he subject . Your against the death penalty or killing someone for an evil act. Ok , thats your stance.
Now i want to create a hypothetical situation.
Youve came across a man that is litterally beating a child to death along the roadside . the child is completely defenseless against this grown man . Are you going to do anything ? Or are you going to stand there while this child dies at the hands of a maniac? You are more than likely going to have to kill this man to stop him , all rational thought has left him . You know my stance , gun or no gun , ill defend this child that i dont even know until i have nothing left , sure there is a good chance i would go to prison because of a screwed up court system for murder or be killed myself , i have no problem with either when facing this situation , but this child would have a chance at a full life. The way i see it , ive lived a good life , ive had some great times and if it means i have to give it all up so a baby can expieriance those things then so be it , i have no problem with that .
But ill tell you now , that apparantly there are more people out there that do not feel the same as me . As a matter of fact , that hypothetical situation i posted actually happened . I believe it was florida or texas , a couple months ago . A man went out of his mind and pulled off to the side of the road , started shouting that his child was a demon and beat this child to death right there in a grassy ditch , while people stood by and watched it happen and did nothing more than call 911.
Pathetic.
Buzzard
01-23-2010, 06:41 PM
So you are telling me that you would never kill anyone ever? If I woke up in the middle of the night to a noise, I would get my gun (Its right by my bed) and look and see what is going on. If there is a person in my house I would shoot them. Would you do the same?
Mark, did you read anything I posted that stated such? There is a big difference in killing for self-defense and killing for pure pleasure.
If such a situation happened where I found someone in my house, depending on the situation is how I would act. If I found an 8 year old kid had broken in to steal some cd's, I surely wouldn't kill them. Each situation would require a different solution.
@Mac: As for your hypothetical situation. It's hard to say what one would actually do when talking about a hypothetical situation, because it isn't a situation that I have encountered. I can say what I think I would do, but wouldn't know how my actual reactions would be unless actually facing the situation in real life. I can say I would act to protect the child, when in actuality I might protect the kid and try to kill the attacker. Either way, I would think that I would act in the child's defense.
NateR
01-23-2010, 07:06 PM
If you are serious about this, I suggest you read up more on it. Hopefully you were joking and that is what the rolleyes emoticon was displaying.
Actually eyewitness accounts fall under the category of Testimonial Evidence in a US court of law. This means that someone actually witnessed the event and is willing to swear to it under oath and under the penalty of perjury.
Testimonial Evidence falls under the larger category of Direct Evidence, the other category being Circumstantial Evidence. Direct and Circumstantial are the two primary types of evidence than can be admitted in a court of law.
Circumstantial evidence requires the jury to draw a conclusion, it doesn't directly attest to the guilt or innocence of the defendant. In other words, finding a piece of string on a woman's dead body would be circumstantial evidence, because it might lead to the killer or it might just be a piece of string that she picked up at some point during the day. There are plenty of explanations for how that string got there, which is what makes it circumstantial.
Direct Evidence is broken up into two categories: Testimonial and Real. Physical objects fall under the category of Real Evidence, which just means that it is a tangible object that you can hold in your hands. Like testimonies, Real Evidence can be tampered with. So nothing is foolproof, which is why our judicial system has so many fail safes built in.
I'm not an expert on law, so I'm not exactly sure where DNA evidence fits into these categories. However, based on what mscomc has been telling us, it appears that the days of using DNA evidence in criminal trials is coming to an end.
So I stand by my statement that:
"eyewitness testimony is some of the best evidence you can have against someone in a court of law."
Do eyewitnesses lie, get details wrong or forget events? Of course, which is why they are cross examined to determine whether their testimony is reliable or not. Unreliable testimony is usually thrown out and not considered by the jury.
Neezar
01-23-2010, 07:09 PM
So I stand by my statement that:
"eyewitness testimony is some of the best evidence you can have against someone in a court of law."
Agreed. It doesn't matter what the evidence shows about eyewitness testimony, a jury loves it. Most prosecutors would have trouble choosing between a good piece of physical evidence and a sturdy eyewitness.
Mark, did you read anything I posted that stated such? There is a big difference in killing for self-defense and killing for pure pleasure.
If such a situation happened where I found someone in my house, depending on the situation is how I would act. If I found an 8 year old kid had broken in to steal some cd's, I surely wouldn't kill them. Each situation would require a different solution.
If you would kill someone in your house than what you are telling me is that you are for the death penalty.
Tyburn
01-24-2010, 10:48 AM
You are kidding about this, aren't you, Nate? :unsure-1:
Because I've read where it is less reliable and I can testify first hand on this myself.
The day we were moving to where we live now we were waiting for the moving guys to get to our house. So I'm standing at the kitchen window and I notice this white pick-up drop this young man off across the street in front of my neighbor's house. I thought this was unusual so I watched him. He walked down the street to a house that had the garage door up and open. He went in and came out with a bag of golf clubs and started walking back down the street towards my house. The really brazen thing is the owner was in his front yard when the guy did this. The owner (an older guy) started after him. I called to my husband and told him to call the police and I went outside to try to stop the guy. My husband soon followed. So when the guy sees us he stops and I tell him we've already called the police and David starts towards the guy, but stops when the guy acts like he's got a weapon. Then the guy motions with his arm (like when you're telling someone to come and get you) so I look up a block and there is that white pick-up truck. The guy in the truck was obviously waiting for him but when he saw what was going on he hightailed it out of there leaving the other guy high and dry. Well the guy drops the clubs and starts walking towards the street leading out of our addition. Unfortunately, David hadn't called the cops already 'cause when I went outside he was worried for me so he called them now. So I run and jump in my car and follow the guy but lose him when he goes between some houses.
This is where the eyewitness part comes in. :laugh: So this young officer arrives and the three of us tell him what happened. So the officer asks us what he was wearing. David and I both answer at the same time. David says "white" t-shirt and I say "black" t-shirt. :rolleyes: I look at David and then I look at the officer and he has this big grin on his face and I know immediately what he's thinking, "how 'unreliable' eyewitness accounts are". :laugh: I mean we had just seen this thief moments ago and we couldn't agree on what he was wearing. We were literally just feet away from the guy. :wacko: So I learned first hand how in the heat of the moment our memories aren't always as reliable as we might think they are and how innocent people might and do get charged with something they didn't do. :wink:
On a side note another funny part of the story. The moving guys showed up right after the cop came. So the cop asks me if I'd ride with him to show him where the guy went and I said sure. So he goes and opens the "back" door of the police car (for some reason I thought I'd get to ride in front) and I get in behind the cage. I look over at the moving guys and they're all looking at us as the cop is putting me in his car. I knew what they were thinking. :laugh: When I got back one of them said, "Yeah, we thought he was taking you away to jail!" :laugh:
I think it depends on how many eyewitnesses you have. Generally eyewitness accounts are good...but not as good as DNA evidence or something...what they do very well is avoiding a trial to begin with by means of providing proof that you couldnt have been committing a crime because you were seen elsewhere :ninja:
Bonnie
01-24-2010, 03:09 PM
I think it depends on how many eyewitnesses you have. Generally eyewitness accounts are good...but not as good as DNA evidence or something...what they do very well is avoiding a trial to begin with by means of providing proof that you couldnt have been committing a crime because you were seen elsewhere :ninja:
I guess what threw me was the word "best" 'cause I was thinking DNA and forensic evidence being better than "eyewitness". :wink: But, Nate also used "some" which I should have noted. :wink: Since DNA has come about there have been quite a few cases (especially rape) that have been overturned where at the original trial they only had the "eyewitness" account. It's not that the woman lied; she simply picked out the wrong guy...unfortunately.
That doesn't mean I'm discounting eyewitness accounts; I'm just saying it's been proven to be less reliable than other means.
Tyburn
01-24-2010, 04:49 PM
I guess what threw me was the word "best" 'cause I was thinking DNA and forensic evidence being better than "eyewitness". :wink: But, Nate also used "some" which I should have noted. :wink: Since DNA has come about there have been quite a few cases (especially rape) that have been overturned where at the original trial they only had the "eyewitness" account. It's not that the woman lied; she simply picked out the wrong guy...unfortunately.
That doesn't mean I'm discounting eyewitness accounts; I'm just saying it's been proven to be less reliable than other means.
It also depends on how soon witnesses are approached. Say you get a statement within an hour of the crime...thats much better then say...a few weeks later...or afew months later...Memories have a way of not only distorting things, but also standardizing things.
If you want to find your credible witness, you need him to be THERE at the time of the crime, and you need to be THERE moments after the crime
....or you want the crime to be so large there are hundreds of witnesses :laugh:
Buzzard
01-25-2010, 06:29 AM
Actually eyewitness accounts fall under the category of Testimonial Evidence in a US court of law. This means that someone actually witnessed the event and is willing to swear to it under oath and under the penalty of perjury.
Many people will lie and swear to many things under oath. Thanks for the lecture on different types of evidence.:rolleyes:
Testimonial Evidence falls under the larger category of Direct Evidence, the other category being Circumstantial Evidence. Direct and Circumstantial are the two primary types of evidence than can be admitted in a court of law.
Circumstantial evidence requires the jury to draw a conclusion, it doesn't directly attest to the guilt or innocence of the defendant. In other words, finding a piece of string on a woman's dead body would be circumstantial evidence, because it might lead to the killer or it might just be a piece of string that she picked up at some point during the day. There are plenty of explanations for how that string got there, which is what makes it circumstantial.
Direct Evidence is broken up into two categories: Testimonial and Real. Physical objects fall under the category of Real Evidence, which just means that it is a tangible object that you can hold in your hands. Like testimonies, Real Evidence can be tampered with. So nothing is foolproof, which is why our judicial system has so many fail safes built in.
I'm not an expert on law, so I'm not exactly sure where DNA evidence fits into these categories. However, based on what mscomc has been telling us, it appears that the days of using DNA evidence in criminal trials is coming to an end.
So I stand by my statement that:
"eyewitness testimony is some of the best evidence you can have against someone in a court of law."
Stand all you want. Don't forget the umbrella, it's raining outside. Maybe if you had added "and some of the worst"to the end of your statement I could agree with you a bit more.
Here are a few interesting links about eyewitness testimony and how unreliable it can be and why. I found the information interesting and in line with some of my own experiences.
http://www.pbs.org/wgbh/pages/frontline/shows/dna/photos/eye/text_06.html
http://agora.stanford.edu/sjls/Issue%20One/fisher&tversky.htm
http://criminaldefense.homestead.com/eyewitnessmisidentification.html
Do eyewitnesses lie, get details wrong or forget events? Of course, which is why they are cross examined to determine whether their testimony is reliable or not. Unreliable testimony is usually thrown out and not considered by the jury.
Unreliable testimony is usually thrown out and not considered by the jury. In a perfect world.
If you would kill someone in your house than what you are telling me is that you are for the death penalty.
Absolutely not. Protecting my life when threatened by an intruder who is out to do grievous bodily harm and possibly killing me is much different than being pro-death penalty. You can see this difference I hope. That's like me saying that since you are for the death penalty you are pro-abortion.
KENTUCKYREDBONE
01-25-2010, 12:52 PM
You know if someone is against both abortion and the death penalty I may not totally agree with them but I can half way understand. What I really cannot understand is those that are for abortion but against the death penalty!
Absolutely not. Protecting my life when threatened by an intruder who is out to do grievous bodily harm and possibly killing me is much different than being pro-death penalty. You can see this difference I hope. That's like me saying that since you are for the death penalty you are pro-abortion.
So you are telling me you can kill someone for breaking into your house, but the court system cannot put someone on death row for the same thing? I hope you can see how stupid that sounds.
Bonnie
01-25-2010, 02:14 PM
Absolutely not. Protecting my life when threatened by an intruder who is out to do grievous bodily harm and possibly killing me is much different than being pro-death penalty. You can see this difference I hope.
You do realize, Buzzard, that the people on death row HAVE ALREADY done grievous bodily harm and killed someone(s), don't you? So if you're willing to kill someone who is threatening to do you bodily harm and possibly kill you, I really don't see the difference. Seems contradictory to me. :wink:
(And yes, I realize that some innocents have fallen through the cracks of justice and been put to death. On the other hand, a LOT of guiltys have also fallen through the cracks and ended up killing again when they should have been put down the first time. IMO
NateR
01-25-2010, 02:37 PM
Many people will lie and swear to many things under oath. Thanks for the lecture on different types of evidence.:rolleyes:
Stand all you want. Don't forget the umbrella, it's raining outside. Maybe if you had added "and some of the worst"to the end of your statement I could agree with you a bit more.
Here are a few interesting links about eyewitness testimony and how unreliable it can be and why. I found the information interesting and in line with some of my own experiences.
http://www.pbs.org/wgbh/pages/frontline/shows/dna/photos/eye/text_06.html
http://agora.stanford.edu/sjls/Issue%20One/fisher&tversky.htm
http://criminaldefense.homestead.com/eyewitnessmisidentification.html
In a perfect world.
Absolutely not. Protecting my life when threatened by an intruder who is out to do grievous bodily harm and possibly killing me is much different than being pro-death penalty. You can see this difference I hope. That's like me saying that since you are for the death penalty you are pro-abortion.
I don't get this. So what you are saying here is that you have the right to kill a dangerous intruder if he is in your home threatening you. However, if that very same man gets away, then your own eyewitness testimony of the crime cannot be considered reliable enough to convict him? :huh:
I don't get this. So what you are saying here is that you have the right to kill a dangerous intruder if he is in your home threatening you. However, if that very same man gets away, then your own eyewitness testimony of the crime cannot be considered reliable enough to convict him? :huh:
Funny!
Buzzard
01-25-2010, 08:54 PM
So you are telling me you can kill someone for breaking into your house, but the court system cannot put someone on death row for the same thing? I hope you can see how stupid that sounds.
I'm not telling you that at all. What sounds stupid are the words you are trying to put into my mouth. Just because someone breaks into my house, I can't kill them. Would you shoot and kill a 7 year old kid if he broke into your house to steal candy money?
You do realize, Buzzard, that the people on death row HAVE ALREADY done grievous bodily harm and killed someone(s), don't you? So if you're willing to kill someone who is threatening to do you bodily harm and possibly kill you, I really don't see the difference. Seems contradictory to me. :wink:
Of course. The difference is that I would be killing an intruder in self-defense. Once someone is in custody, I would be guilty of murder if I killed them. I sure hope you can see the difference.
I don't get this. So what you are saying here is that you have the right to kill a dangerous intruder if he is in your home threatening you. However, if that very same man gets away, then your own eyewitness testimony of the crime cannot be considered reliable enough to convict him? :huh:
I'm not saying that at all, you are. I questioned your statement about eye-witness testimony, not eye-witness testimony itself.
Just because someone threatens you, does not mean you get to automatically kill them. Read up on the use of deadly force, the information there might shed some light for you.
Miss Foxy
01-25-2010, 09:09 PM
You know if someone is against both abortion and the death penalty I may not totally agree with them but I can half way understand. What I really cannot understand is those that are for abortion but against the death penalty!
+1!!
NateR
01-25-2010, 09:30 PM
I'm not saying that at all, you are. I questioned your statement about eye-witness testimony, not eye-witness testimony itself.
Okay, so what do you consider to be reliable evidence in a court of law? Photos and videos can be digitally altered. DNA and fingerprint evidence can be planted. Most physical evidence is circumstantial. Even confessions can be coerced. So what do you consider to be reliable evidence against criminals?
Just because someone threatens you, does not mean you get to automatically kill them. Read up on the use of deadly force, the information there might shed some light for you.
No one is claiming that they can kill anyone who threatens them. That's just you putting words into our mouths like you are claiming that we do to you.
Buzzard
01-25-2010, 10:32 PM
Okay, so what do you consider to be reliable evidence in a court of law? Photos and videos can be digitally altered. DNA and fingerprint evidence can be planted. Most physical evidence is circumstantial. Even confessions can be coerced. So what do you consider to be reliable evidence against criminals?
No one is claiming that they can kill anyone who threatens them. That's just you putting words into our mouths like you are claiming that we do to you.
If you re-read my statement you will see that I didn't put words in anyone's mouth. Nice try though. My statement was in answer to your statement below.
So what you are saying here is that you have the right to kill a dangerous intruder if he is in your home threatening you.
I believe in many things, just not the God as is portrayed by man. When I die, I die. I don't think anyone goes to heaven as I don't believe in the concept of heaven. Perhaps heaven is in another dimension or not, but I honestly don't believe in it. I could be wrong and I'm not saying there isn't a heaven, as I really don't know if there is or not. My gut belief is that there isn't.
Do you believe in Hell?
Tyburn
01-25-2010, 11:02 PM
Do you believe in Hell?
Good Question :ninja:
I don't see scripture as being the true word of God.
What is the true word of god?
Tyburn
01-25-2010, 11:40 PM
What is the true word of god?
Another good question :ninja:
Mark is on a roll tonight :happydancing:
Buzzard
01-26-2010, 04:01 AM
Do you believe in Hell?
No, I don't believe in either heaven or hell.
What is the true word of god?
Since I don't believe in God, I don't believe in a "true word of God" and certainly don't believe that the Bible is the true word of God. The Bible was written by man, and many stories in there were plagiarized from earlier stories and myths. Look it up if you don't believe me.
No, I don't believe in either heaven or hell.
Since I don't believe in God, I don't believe in a "true word of God" and certainly don't believe that the Bible is the true word of God. The Bible was written by man, and many stories in there were plagiarized from earlier stories and myths. Look it up if you don't believe me.
I dont believe you. I dont need to look it up.
NateR
01-26-2010, 01:02 PM
I dont believe you. I dont need to look it up.
Even if you did want to look it up, don't bother asking Buzzard to actually provide any evidence for his claims. He'd just point you to a bunch of blogs and opinion websites. :laugh:
Tyburn
01-26-2010, 04:40 PM
I dont believe you. I dont need to look it up.
I had this problem with Buzzard when he first arrived. He doesnt have any desire to learn or discuss or debate...he is just out to cause fuss...I remember speaking about it in one of my Blogs...around the 75th I think...so give or take Twenty Five Weeks ago :laugh:
Buzzard
01-26-2010, 10:39 PM
I dont believe you. I dont need to look it up.
Live in denial if you wish. The information is out there for you to read. Have you ever read the story of Gilgamesh? Have you ever read about Horus? So many similarities between them and other mythological stories.
Even if you did want to look it up, don't bother asking Buzzard to actually provide any evidence for his claims. He'd just point you to a bunch of blogs and opinion websites. :laugh:
There is more than enough evidence out there to support my claim. A lot of it is available on the internet, but since it's on the internet it can't be true. I really don't feel like wasting my time providing anything because your mind is already set. Read up on the two stories about Gilgamesh and Horus and see for yourself. Fiction is fiction, and plagiarized fiction is still fiction. If it works for you, that's great. It doesn't work for me though.
I had this problem with Buzzard when he first arrived. He doesnt have any desire to learn or discuss or debate...he is just out to cause fuss...I remember speaking about it in one of my Blogs...around the 75th I think...so give or take Twenty Five Weeks ago :laugh:
Yawn. I have a desire to debate, learn, and discuss, but only with people who are able to clearly state their point, unlike you. It's quite hard to take you seriously when you can't focus and remain on said point. Plus your lack of basic knowledge causes me to question the validity of anything you post. If you can't grasp the basics, I doubt that you have fully understood some of the more intricate subjects.
Buzzard
Did you grow up in a Christian household? Do your parents have religion? How did you come to this conclusion with religion?
Tyburn
01-26-2010, 10:49 PM
Yawn. I have a desire to debate, learn, and discuss, but only with people who are able to clearly state their point, unlike you. It's quite hard to take you seriously when you can't focus and remain on said point. Plus your lack of basic knowledge causes me to question the validity of anything you post. If you can't grasp the basics, I doubt that you have fully understood some of the more intricate subjects.
Clearly state their point? what you mean like you couldnt do when I asked you the simple question, that if your not Christian, and you believe your moral basis to be more then a mere opinion...what is it based on...specifically, the knowledge of right and wrong...which isnt covered under the golden rule...oh yes Buzzard...I remember that one...dont make me fish that thread out and PROVE which of us has a problem with clarity of expression.
Buzzard
01-27-2010, 02:39 AM
Buzzard
Did you grow up in a Christian household? Do your parents have religion? How did you come to this conclusion with religion?
1. Yes.
2. They did when they were alive.
3. Through life and seeking answers to questions that I had. I don't think a belief in God is a bad thing. In fact many valuable lessons can be learned through religion. I am skeptical and questioning by nature, I always have been. In my adult years I found that I am agnostic in my religious beliefs. I am highly skeptical in the claims of the various religions that I have been exposed to.
Clearly state their point? what you mean like you couldnt do when I asked you the simple question, that if your not Christian, and you believe your moral basis to be more then a mere opinion...what is it based on...specifically, the knowledge of right and wrong...which isnt covered under the golden rule...oh yes Buzzard...I remember that one...dont make me fish that thread out and PROVE which of us has a problem with clarity of expression.
Yes, clearly state your point. I answered your question, but not to your liking. Your problem, not mine.
1. Yes.
2. They did when they were alive.
Where are you parents now, where would you think they are?
Buzzard
01-27-2010, 02:47 AM
Where are you parents now, where would you think they are?
Their physical remains are interred in a cemetery. My memories of them are in my mind and heart.
Bonnie
01-27-2010, 04:33 AM
Of course. The difference is that I would be killing an intruder in self-defense. Once someone is in custody, I would be guilty of murder if I killed them. I sure hope you can see the difference.
Where did you get your "conscience" from? Where does "it's wrong to kill/murder" come from? Were you taught that by your mom and dad or did you come to that conclusion on your own?
And, lastly, where did we "man" come from? Since you don't believe in GOD I take it you don't believe he created us...
Maybe your answers to these ?s will help us "understand" you better....or....not.
Buzzard
01-27-2010, 06:08 AM
Where did you get your "conscience" from? Where does "it's wrong to kill/murder" come from? Were you taught that by your mom and dad or did you come to that conclusion on your own?
I was raised and taught many things from my parents and school. The "Golden Rule" was also instilled in me at a young age, along with some religious upbringing. The 10 commandments are also a good learning tool. I was raised well and manners were something that were taught to me at a very young age and throughout my formative years. Some lessons were learned the hard way. As for the murder question, upbringing and common sense paved that path.
And, lastly, where did we "man" come from? Since you don't believe in GOD I take it you don't believe he created us...
Maybe your answers to these ?s will help us "understand" you better....or....not.
I came from the stork, didn't everyone? I don't have a definitive answer for your last question. I can speculate, but can't say for sure. If I find out, I'll be sure to keep you in the loop though. Who knows, maybe sometime in my lifetime definitive answers will become available as our knowledge grows. I'm not going to lose sleep over it though. I hope that I have answered your questions. If you have more, please feel free to ask.
Bonnie
01-27-2010, 06:56 AM
I was raised and taught many things from my parents and school. The "Golden Rule" was also instilled in me at a young age, along with some religious upbringing. The 10 commandments are also a good learning tool. I was raised well and manners were something that were taught to me at a very young age and throughout my formative years. Some lessons were learned the hard way. As for the murder question, upbringing and common sense paved that path.
Since I don't believe in God, I don't believe in a "true word of God" and certainly don't believe that the Bible is the true word of God. The Bible was written by man, and many stories in there were plagiarized from earlier stories and myths. Look it up if you don't believe me.
:huh: :blink: Are you keeping track of the things you are saying?
I came from the stork, didn't everyone? I don't have a definitive answer for your last question. I can speculate, but can't say for sure. If I find out, I'll be sure to keep you in the loop though. Who knows, maybe sometime in my lifetime definitive answers will become available as our knowledge grows. I'm not going to lose sleep over it though. I hope that I have answered your questions. If you have more, please feel free to ask.
You do that. "Cause I certainly want to be in the "loop".
Thank you, but I think I need to go rest now, my head is spinning.
Tyburn
01-27-2010, 11:39 AM
I answered your question, but not to your liking. Your problem, not mine.
No you didnt answer it. Please do so now. Succinctly if you can. :ninja:
Buzzard
01-27-2010, 08:04 PM
:huh: :blink: Are you keeping track of the things you are saying?
Of course I am. No contradictions in my statement. One can learn from religious doctrine without believing it is the "true word of God". There are some good lessons about life in there. Same as with the ten commandments, they are basic life rules and don't need to be the "true word of God" to follow them.
You do that. "Cause I certainly want to be in the "loop".
Thank you, but I think I need to go rest now, my head is spinning.
I hope that my explanation settles your spinning head. Maybe it's spinning because you are in the loop.:wink:
No you didnt answer it. Please do so now. Succinctly if you can. :ninja:
I've even answered the question partly or completely in this post. I suggest that you go back and look for yourself as I see no need in repeating myself. Have fun storming the castle!
lol. WoW. Let me guess, you're and evolutionist Buzzard?
Buzzard
01-28-2010, 02:13 AM
lol. WoW. Let me guess, you're and evolutionist Buzzard?
Nope, I'm Caucasian.:wink:
Tyburn
01-28-2010, 07:34 PM
I see no need in repeating myself.
Oh go on. Humour me :laugh:
Neezar
01-28-2010, 11:38 PM
Oh go on. Humour me :laugh:
:laugh:
No, I am Agnostic.
What do you think about Jesus?
Jesus was a historical character.
Jesus was crucified and rose from the dead.
Jesus taught his 12 disciples (later called apostles) the truth.
These disciples accurately wrote-down the teachings of Jesus.
These disciples accurately passed-on the teachings of Jesus to the next generation of church leaders.
The writings and teachings of the disciples are true.
Paul the apostle was also given the same truth by Jesus and accurately wrote it down and passed-it on.
The Bible contains these true writings and does not contain any untrue writings.
The church accurately teaches this truth which was passed-on from the apostles.
Spiritwalker
01-29-2010, 03:22 AM
These disciples accurately wrote-down the teachings of Jesus.
These disciples accurately passed-on the teachings of Jesus to the next generation of church leaders.
The writings and teachings of the disciples are true.
There is where I begin to have my issues.
Tyburn
01-29-2010, 11:18 AM
The church accurately teaches this truth which was passed-on from the apostles.
This is the only bit I have a problem with. I aggree thats what the church should do...but sometimes I wonder if its in practise what happens...I note also that you've included your own form of Apostolic Succession...and in that sense I wholeheartedly aggree with you..."From Generation to Generation" as the Scriptures often say.
Does that make us Apostles then? :huh: I mean this succession is not physically natural, but it is Spiritual, in a heavenly perspective, are we not the descendants in faith of those disciples and those who led the Early Church?
What do you think about Jesus?
Jesus was a historical character.
Jesus was crucified and rose from the dead.
Jesus taught his 12 disciples (later called apostles) the truth.
These disciples accurately wrote-down the teachings of Jesus.
These disciples accurately passed-on the teachings of Jesus to the next generation of church leaders.
The writings and teachings of the disciples are true.
Paul the apostle was also given the same truth by Jesus and accurately wrote it down and passed-it on.
The Bible contains these true writings and does not contain any untrue writings.
The church accurately teaches this truth which was passed-on from the apostles.
Damn....Mark laid the smack down! :cool:
vBulletin® v3.8.4, Copyright ©2000-2013, Jelsoft Enterprises Ltd.